Transcript

slc7a3a-201

ID
ZDB-TSCRIPT-090929-18812
Name
slc7a3a-201
Previous Names
  • slc7a3-001
  • slc7a3a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038429 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038429|OTTDARG00000028266|ZDB-GENE-041114-206 slc7a3a|OTTDARP00000030799 slc7a3-001 LG_none CR749164.18,CT025910.8 Danio rerio protein_coding KNOWN, 4457 bp
GGAGCCGAGGCTGATCATTTGCACTCGGGCAGACAAAGTA
AATACAACAAACCGAAGTTCCCTGCATCACAAGCCAAGAG
GCAAATAAAAACCAGCACAACCAACAACCTCACCAGATCT
GGAATTAACCATGGTGGACAAGATGGCCTCTTTCGGACAC
ATCCTGCTGCGGCGGCGGGCGCTAGATTTTTCAGGAGAGG
AGACGCGGTTTGCTCGGTGTTTGTCCACACTGGACCTGGT
GGCTCTCGGCGTGGGATCAACACTGGGTGCTGGAGTTTAC
GTTCTGGCTGGAGAAGTTGCAAGAGAGAAGGCTGGTCCTG
CTATAGTGTTATGCTTCCTCGTGGCCGCTCTTTCCTCCAT
GCTGGCTGGATTGTGCTATGCAGAATTCGGCGCTCGAGTC
CCGAAGACTGGATCTGCATACTTGTATAGCTACGTAACAG
TTGGCGAAATCTGGGCCTTCATCACTGGTTGGAACCTCAT
CCTCTCATATGTTATAGGTACAGCTAGCGTGGCTCGAGCT
TGGAGCTCTACGTTTGATAACTTGATTGAGCAGAAGATCT
CCAACTTCTTCAGGGCATCGATGGCCATGAAAGTTCCTGG
GAAAGTCCTTGCTGAATATCCAGACTTGTTTGCCCTCATT
CTCATCTTGCTACTGACTGGATTGCTCGCTTTCGGTGTGA
GCGAGTCTGCTCTGGTCAACAAGATCTTCACCGGGATCAA
TCTGATCGTGCTGGGCTTCATCATCATCTCCGGCTTCGTC
AAAGGCAACACGGCAAACTGGAACCTGACCTACGAGTACT
TCATCAACGATACAAACATCACCGAACCAGAACGGATAGA
AAGCACATTTGGAAGTGGAGGCTTTGCTCCGTTCGGCCTT
GGCGGCATCTTATCAGGCGCAGCCACCTGTTTCTACGCCT
TCGTGGGCTTTGATTGCATTGCTACGACAAGTGAGGAAGC
CAAAAACCCAATGCGCTCCATCCCTGTGGGCATCGTGGCC
TCGTTGCTCATTTGCTTCTTTGCTTACTTTGGTGTCTCAG
CTGCTCTTACGCTCATGATGCCCTATTACAAGCTCAACAC
TCAGAGTCCTCTGCCTGAGGCCTTCAGTTACGTAGGCTGG
GCACCAGCACGATATATTGTAGCCGTGGGTTCACTCTGTG
CTCTTTCCACAAGTTTGCTGGGCTCCATGTTCCCTATGCC
TCGAGTGATTTACGCCATGGCTGAGGACGGGCTACTCTTT
CGTTCACTTTCCAGGATGAACAAGAGAACCAAAACTCCTC
TGCTGGCGACTATTGCGTCTGGAATAGTGGCAGCTCTCAT
GGCGTTTCTGTTTGATCTGGCTGCGTTGGTTGACCTCATG
TCCATTGGGACGTTGCTTGCGTACTCTCTTGTGGCTGTTT
GCGTTCTCATCCTCAGATATCAGCCAGGGAACCTGAGCTC
CTCCAGTCAGACTGAGAAGCTGGTGGAGCTGGTTGGTGGG
GAGAAGGTGGCCGTTTGTGGAGACAGTGGAGATGAATATG
GCGTAGAGCTGGATGACAGTCCTCGCAAGGAGAAATTCAC
TGCCAAACTCCTCCTGGTTCCCTCCAAAGACTCGCCAACG
GAAATGTCAGGAACTATCGTCTATGGCACAACTGCAATTA
TCTCTGTGCTGATCACGGTGCTGTGCGTGGTTTTGGCTCA
GCGTCTGGAGTCCATCATAAATCTGGAGATCGTGTGGGTG
ACGGCGTGTGTCATTCTGGTCCTGCTGTGTGTCCTGTGTG
TGATTGTGATCTTCAGGCAGCCGGAGAGTAAAGAAGCTCT
CACCTTCAAGGTGCCTCTGTTGCCTTGGCTTCCTCTGTTC
AGCATCTTCGTCAACATTTATCTGATGATGCAGCTGGACG
TGGCCACCTGGTGCCGCTTCACCGTGTGGATGGCCATCGG
TTTTGCCATCTACTTCGGCTACGGCATTTGGCACAGCACT
GAAGCCATGAATAGCTCGGTCCGAAAATACGAGCCGGCCC
TTCAGAACAAAAGCCCCATCTATTTAGGCGGTGAGGAGAG
TGAAATTGAGGGCATTTCTCCTTGATGAAGAAAAAGGAAT
GAAAGAAAACCCCGACAGGCATGTTTCCGTTCAAGTCTAC
AGATTTAATTTTATTGTAGAGACTGCCCCGAACCTCTTAA
TTCAGGTTGCTTTTAGCAGAAGCGTTAAGTGTTTCCCGTT
AGAAGTGCAGCCTTGGCCCCTCAGTGCTGTAGATGTTGGT
TTAATGTCCGTTCGGCTGCTGCTGTAATTCATAAGTACTG
TAACAGCCATATTGTCTGGCAGACAATGAGCTGACTGTGT
ACAGGGTATTATGTTTTCATCATCGAGGTCCAAGCACATT
TTTTTATTCGTGCGCGAAAAGCCTCCCGAGTCCAAACTGT
TTATTGTCAACCTTGTGGTTTTTCAAGGTTGTGAAGTACA
ACAGAGGCCCCTAGTGTTCAGAATGTGAAAACGGCAATGC
CTTCAGGCAGTATTTGAGGTCATTGGTTACAGTTAGGCGG
AGGAATTGAAGAATTAAAACTGACAAAGCTTTTTTAAATA
TTTTAGCATGGCTGAGGTCCCATGTGTATGAGAGTCGTCC
AAAGAGTGCGTGGAAAATAACATAATCGTTTCCATTTTCC
TAAATATGACAGCTGTGTGCTGTATGTTGGGATCAGCCAT
TAAAATGATGTATTTTTAAGCGTGTATGAGAGTTTTTGAA
TGGCTCATAAGAGGTCAAGCCAGAAAATGTTCCATTTTAC
AGAAAAAACTAAAATATTTTTTTGGGAAAAACCTGTTTTA
TATGAATATTTATAGTTTACCCATTCACACAAGTTCCTTA
GACTTGATTATACTTCAGAAAACTGTATAACAGCTATCAT
ATTTCCAGACGCTGCTTAAAAAAGTTGCTATGTAACTATA
GTTTCTGCTGAAACTACTTGCATTACCGTTCAAAAGTGGT
TGTGTTTTGACCAAATATGTTTTCTTCCAGAAAACATTCA
ATTGTGGAAGACGTTATATATATATTTTTTTCGCAAAAGT
ATTAAGCAACACAACTGATTTCAACACTGAAAACAAGATG
AGCTGTAAATCAGCATACTCTGACTTCTGAAATATCAACA
CTGAAGTAACGGCTGCTGAAAAATTGGCTGAATTTGTTTA
CGCAGATGTGTATACTTCAGTTAAGTGTGCAATCACACCA
TGTCATAATTACAGAAGCCCAAATAGTGATGAAACTTACT
AGAATATACTTATACACAGACCATCATTCATTCACATTAC
ATCTAAGGTATACTTTGACTTTTGGAATTTCAAATATGCC
CTAAATTATAATAATTCACTGTTTTTGTAAAGAAAGCAGA
CACATATTAACGGTTAACTGTTTAATTGCCGATAAAAACT
ACTGCTGACTTGAAAGATTCTGAAAAGCTATATGGTTAGA
AGGACTTTGAACAGTATTAGCTGAGCAGAAACTGTAGTTA
CCGCTCTAGCTTTGTTAGCAAGGCTAGTCTGCAATAATAA
CCAACTCACAGGTCAAGGGTTAAACCTAAACTTGCCTAAG
GAATGAAGATCTAATGAAACAGGCTTCGAATGGCCTTTCT
TTCATATCTGAAGGTGTAGATACTTGAGAAATAAGTGTCT
CTATTGCTTTTATTTGTATTATTATTGTTGTTGTTTTTCA
TTGAAACTTGTTCTTGGCAGCTTGGCTGTTGAGCTCATGT
ACCGTTCTCTACTTTTGTTCAATATTGTAATGTAGTGTAT
TACTATTGTCACTTATCTTGTTCACACATCATATCTTTTT
GATTTGTTTATATAGTATGACTATTTAACCCTTTGAGGAG
CTGAGTTTCAGCTCTGTTTCAGCCAGTTTTGGTGGGTTGT
GTTGTTTATTTTTGTTAGTGTGTTCAGATAATCAGATAGA
AATGAAGGCTTGTCTTTAAGACAAGATGGAGGTTTAAAAT
CACTTTTTAAACACTATTGTTTAATTTAAAACCACTGTTG
TTTTGAAACCCATTGCTCTCTTTAATGAATTAACATGATT
AGAAGCCTATTTTTGTATAGCTTTACTATCTGTTTCGCAA
TCAACTGAGTTGTTGTTTACATGTACCAGACATGTAAAGT
TTAGCATGTAAACATGTCCAAACACTGTCTGATTCCAGGC
ATTACAAACTTTTGATTCAATATGGAGGCTTGTGTCTCCT
GTAGATCAGTGCCTGATGTTTCAAATGTACCTCAAAGTTG
GTTGGTAGGTATCAAAATAAATACCAAGTCCTGTTATATG
CCTTTGAGATACACTTGTAGTGTTACATGTGTCTGTTTAT
CAGCATATGAATATATATATATTGTTTGTCCTTGGGTTTT
TTAAAACTGTAAATAGTCATGCCATGTACAAAGAAAATGA
CCTGTATTATAAACATTTCTGTTTTTCTTTTTTAAAATAA
AATGTTTCGCAAAACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations