header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18784
Transcript Name: gss-201
Previous Names: gss-001, zgc:101574-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038401 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038401|OTTDARG00000028246|ZDB-GENE-041010-208 gss|OTTDARP00000030772 DKEY-78O15.2-001 LG_ CR318666.9 Danio rerio protein_coding KNOWN, 2050 bp
TTGCGTCATAACTATCCTGTTCGCTGATTGGTCGCTGTCA
GCCATTGATACAAACAGCGCCACACACACACACGCACACA
CACATACATTTACATATCTATTAGCACGCCTGAAGCCACT
TCATTTGTGTCAGTCTCATCACCTTCAGAGCAGGTGAATA
GGCATTAAATATATTATACAGACTCACTGTAAACAACGAC
CTTCAGAGGCGCAGGAGAGACCAAACAGAGCCCGCGACTA
TCAGATTTAGTACTATGTCTGTCAAACTGGAGGACACCCT
GAAAGATGAAAACCTGATCAAACGTTTAGAGGAGATAGCA
AAAGACACGGCGCTGTTACATGGAGTGTTGATGCGGACCA
AAGACACGCCAAACTCTCCTGAAGTGGTGAGTTATGCACC
ATTCACATTGTTTCCCACATCGGTGCCAGCAGCACTCTTT
CATCAGGCACTGGCAGTGCAGACACAGTTTAACCGCTTGG
TGGACCGGGTCAGCCAGAATCACAGTTTTTTAGAGGACAC
ACTGGCCAGCACCATCAAAGTTGACGATTTTACAGCCAGA
CTTTTCAACATCTACAAACAAGTTCAGCAGGAGGGCCATG
CTCAGAAAATAGTAGTGGGTCTGAATCGCTCAGACTACAT
GTTAGACCACAGTCCAGACGGTCGAACATCTCTGAAGCAG
ATTGAAATCAACACTATTGCTGCGAGTTTTGGTGGTCTTG
CTTCACGAACACCAGATGTCCATCGGCACATTCTGAAGGT
GGCAAACCTGCCAGATGAGTGCAGTCTTGTTCTCGACAAC
AACCCAGCAGCAGGTCTGGCCAAAGGTTTGGCCAAGGCCT
GGGAGCTTTATGGATCCAAGAGGGCAGTGGTTTTGTTTCT
GGTTGAGAATGTACAGAGGAATATTTATGACCATCGATAT
GTGGAGAACGAGCTGTGGAAAAGAAATATACCTGTAATAA
GAAGACAATTTGAAGATGTTTTCAGGACTGGATCTCTGGA
TGAAAGCAAGAGGCTCTTCGTAGATGGCCATGAGGTAGCC
ATTGTCTACTTCCGAAATGGATACATGCCTCAAAACTACA
CCTCAGAGCAGAGCTGGGAGGTGCGTTTGATGATGGAGCG
CTCCGTGGCAGTGAAGTGTCCAGATATCAGCACTCATCTC
GCTGGGACTAAGAAAGTCCAGCAGGAATTAGCCCGGCCAG
GTGTTCTGGAGTGCTTTTTCCCTGACGAACCTGAAACAGT
TGCTCAGATCCGGGCGACTTTTGCTGGACTGTACACGCTG
GACATGGGGGAAGAAGGTGATAATACCGTAGCGATGGCTT
TGGCCAATCCAGATCAGTATGTGCTGAAGCCTCAGAGGGA
GGGAGGAGGTAACAATATCTACGGCAGTGAGATCTGCGAA
GTGTTGGAGAAGCTGAAGAACTCCAGTGAGAGAACAGCCT
ACATCCTGATGGACAAGATCCAGCCCGTCCCAGTCCAGAA
CATCCTGCTCAGACCCGGAGCTCCTCTGAAAGTCAGCTCC
TGTCTCAGTGAACTGGGTGCATTCGGGGCGTACGTCAGGA
AAGGCAGTGAATTGATGTTGAATGAGTGCGTTGGTCATCT
TCTAAGGACCAAGAGCTCGGAGCATGCAGATGGCGGCGTT
GCTGCAGGAGTAGCAGTGCTGGACAATCCACTTCTGGTCT
GAACCACGGCGACACATGCTGTACTGGAGGAGAAACGCGT
ATGACTGACATCGGGGGATTCAGCCCAAATCATTTCTACC
TGAGACCTGTTTGATCAAAGATTTAGAGTTGAATATCCTC
TATTGATGAAGTAATCAATCAGTTATGACTGAACTACTTA
TTTCCTCAATAAGTTTTATACCTCATTCAAGGGTTGATCT
GTTGATGTTTAGCCGTTAATGTTTTATAAAAGCAAATTTT
GTTAATGCTTTCTTGGATGGTAACAGATGTTATTAACTCT
CTGGTGATGTTCATTTAGTCATCACACTTGTGTAGTTCAC
TGTCAAAACAGACTGGAGACCATAGTCCTAAAGAGTCCGA
AATTTACCCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gss-201 Contained in:
OTHER gss-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038401 (1)
  • Ensembl_Trans:ENSDART00000054909 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC083207 (1) 2005bp
    GenBank:CK685319 (1) 767bp
    CITATIONS (2)