Community Action Needed: Please respond to the NIH RFI
Transcript

wnt1-201

ID
ZDB-TSCRIPT-090929-18590
Name
wnt1-201
Previous Names
  • wnt1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038199 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038199|OTTDARG00000028143|ZDB-GENE-980526-526 wnt1|OTTDARP00000030615 wnt1-001 LG_ CR352210.11 Danio rerio protein_coding KNOWN, 1360 bp
TGCGTGAATCTGATTTGAGGTTAATTGGTTAACTTTGCCC
TTTCAGATATCATGCGGGTTCTCGCGTTGCTTCTCGCAGT
TAAAGCGGCATGTGTCCTCCTGGTGTCCTCTCTCACTGGC
ACAGGGGCGGTCAACAACAGCGGCCGGTGGTGGGGTATAG
TGAATGTGGCATCCTCGGGCAATCTCCTCACTAACTCTAA
GAATGTGCAGCTGGTACTCGACCCAAGCCTGGCACTGCTA
AGTCGCCGCCAGAGAAAGCTGATCAGGCAAAACCCTGGCA
TCCTTCATGCTATTGCAGCAGGTCTGCACACAGCCATCAA
AGAATGCAAATGGCAGTTTCGTAACCGTCGTTGGAACTGT
CCCACTACCCACAGCCCCAATGTCTTTGGCAAAATTGTCA
ACCGAGGTTGTCGCGAGACTGCGTTTGTGTTTGCCATTAC
AAGTGCTGGTGTTACTCACGCCGTGGCTCGGTCCTGCTCT
GAAGGGGCCATTGAGTCCTGCACCTGTGACTACCGGCGCC
GTGGTCCTGGAGGGCCAGACTGGCACTGGGGAGGCTGCAG
CGACAATGTGGAATTTGGCAGGATGTTTGGACGAGAGTTT
GTGGATTCCAGCGAGAGGGGCAGAGATCTACGCTATCTGA
CCAACCTGCACAACAATGAGGCAGGGCGAATGACTGTCGC
ATCAGAGATGCAGCAGGAGTGCAAGTGTCACGGGATGTCT
GGATCCTGCACTGTGCGAACTTGTTGGATGAGACTTCCCA
GCTTCCGTTTAGTGGGAGATTACCTGAAGGACCGTTTTGA
CGGCGCATCCCGAGTTGTGTATGCCAACAAAGGCAGCAAT
CGCGCATCCCATCGAGCAGATCCCCGACACCTGGAACCAG
AAAACCCAGCGCATAAACTCCCTTCATCTCGGGATCTCGT
CTACTTTGAAAAATCACCTAACTTCTGTTCCTACAATGGC
AAAACTGGAACACACGGCACATCAGGACGTACCTGCAACA
GTTCGTCGCCAGCTCTGGATGGGTGCGAGCTGCTGTGCTG
CGGAAGAGGATACAAGACTCGAATGGAGCAGGTCACCGAA
AGATGCCACTGTACTTTCCACTGGTGCTGCCATGTGAGCT
GCCTCAACTGCACCAGCACACAGACTGTCCATCAGTGTCT
ATGAGGAGAAAACACAACCGACTCACAAACTGGAGGAGAA
GGCTCCCAAATTGGCTATAGAAATGGGCCATTGAGGTGAC
CCTGGGTTCTCAGCTCTTGCCCTGGAGGAGTTTTGTTTGT
CTTTCCTATCTGAAACGCATGCTTCAGTTCATGAAGCTTA
CAGCTAATGTGTTGATGTTCTGAATCCGGGGTGGTAAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations