Transcript

scn4ba-201

ID
ZDB-TSCRIPT-090929-18497
Name
scn4ba-201
Previous Names
  • scn4ba-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038105 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038105|OTTDARG00000028098|ZDB-GENE-070615-18 scn4ba|OTTDARP00000030540 scn4ba-001 LG_ BX901957.4 Danio rerio protein_coding KNOWN, 2072 bp
ATTCTTTCCTGCGCCGGCAACAGACACAAACCGCCCCCCC
TCCACCCCTCCTCTGTCCACTCATCCCAGCATGCGCCACC
TATTCGGGGGTAAGACCAACAGACTCTTCCCCGGACTGAA
AGCAAAGCTCTGCGGTGCGGCTGTTGCTGAATGAATGCAG
CGTTTTCTTGCACCTACAACCGCACTGAGTGAGACAGAAT
ATCAGCGAGACACTGCCGGCAACTGAGAGCCACTGATCTG
AAGAGCAGAACAGCAGATCAGGTGCTGCCTCCGTATTTCT
TGCTCTTCAGTTCTCCCTCCCTCCTCAGGACACACTGCGA
AGGAGGACTGAGGACAGGGAGGTACTCCGCAAGACTTCCC
CAGCTGAAAGTCTTTCTGTTTTGATTTTGTGACGGGTCCC
GTGTGACCCCTCAACACCTCTCCCTCAGATCTTAAGTATC
CTGCCAAAGACACATAGCAGGGGACCAGGAACAGACAGAC
AGGCACAAGTGAGCAGACGGTCTGACATGGAGTTGCAGGG
GAGAAAATCATTCCTGCACAGGTGTGCGAAGTCTGGCGAT
GTAGTCCATGCAGGTCTGGTCATCACACTTCTAGTTGGAG
TCTGGTACTCTCAGGCACTGGAGGTGAGCACAGGGAAGGT
CCATTTCATAGAAGTGATGAATGGAAGTTCAGTGTTGTTA
CCTTGCACTTACGCCAGCTGCATCGGCATTAAAAACCTTT
ACTTCAGCTGGCAGTTCAAGGACAATGGGACACTAATTAA
GCTGTGTGAAGCCGTCATCCCAGGAGAAGGAATAGAGCCT
AATGTGAAAATCTACCATGAGCGGGTGGAGTTTGTAGGCA
CCAGCAAGAAAAGTAACATCTCCATCCTACTGCATAATGT
CACGTTCGAGGACCAGGGAGAATATATCTGCTTCGCTCGC
AACCCCAAAGAGAAGGACCGCAACCATAGTGCGGTTTTCA
CTCTTTATGTGGTAGATGAGTTGAGAGTGGTGGACAACAC
ACTGACCCTCATCATTGTGTCTGTGCTCGGTGGGGTCATC
GGTCTCATCATCCTCATCATGGTGGTGAAAGCTGTAGTCA
TTGCTGTTCTAAACAGGGTCCAGGAGAAGAATAAAGAGTG
CCTTGTGAGCTCTTCAGGGAACGACAACACAGAAAATGGC
CTCCCAGGATCCAAAGCAGACAGCAAACCAACACCAAAGG
CATGAGAGGAGCATGTATGTGTACATATATGAGCATATGT
ATACATGCATTCACATTTATAACAGATTGAAGGAAAGTCA
TAAAAACGGACAGTTTTATTCTCTTTATCTCAAAAAGAAA
ACAAATGCTACATATAAATGTGTGAACATAAATATATGAA
CTATATTTTAGATTGTGCTTGAAAAATATAACATGCTGCT
GGCTGGATCGCACTCCCTTCACTAAACTGGAAAAAATGGA
AGAAAAATTATAATCTTAATGGTTCGGTGTGCTTGCATTC
TGCTCTCTCTTGTCAGCAAGACACAGCACACACACACTGC
CTTCTTCACAAACTGCCATATCCTTTCAATGCTAGACAGC
ACAAGTCCCACAAAACAAAAGGTTTGCGATAAACTTCTCC
AGTGCAACTTTAACACATCTTCACACTGCATTCCAAATGA
CCCTTGGTGGAAGTCAGTAACAAAACAGACTTTACGAAAA
TAAAGAATTTACACATAAAACCATGGGTGCCTCTAAAAAT
TGGAAAATGTTTACCACTGATTCAAGCAGCTAACTGAGTC
TATTAACCAGTCCCACTAATTTTACAAGTGATTTTAAGGT
CATAAAGAGCAGGATGTAAGCACACCCGAAGGCCAGAAAC
ACACTCTACGCAACAACACCCCCCTGTGGAAATGCTGAGA
ATGCAACAAAAAATAGAGGTTGCGTAGAGTATTTTTCATG
CATATGGGTATTTTGTAAAGGATCTGAAAGAACTTTTTTT
TTCACAGAGATGTAGATAAAGGGTGTATTTCCAGGATCCA
GCTGAGCACGGTTTATTCTATTTATTTAATTTTCCTGCTT
TAGATAAAACACAGGTGCCTGTAAACGCTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations