Transcript

btr02-002

ID
ZDB-TSCRIPT-090929-18486
Name
btr02-002
Previous Names
  • zgc:153136-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038094 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038094|OTTDARG00000028092|ZDB-GENE-060825-228 btr02|no_translation DKEY-285G17.3-002 LG_none BX682554.3,BX682552.9 Danio rerio protein_coding KNOWN, 2041 bp
ACTTTATGAAACTCACCATACTGAAAGAGACAAGAGCGAC
TCACTACAAACACTAAAGGCACTACAGGGATGGAGTCCAC
CCTCAGTCAACTGTCGGAGAAGCACTTCTTGTGCTCTCTG
TGTGAGGAGATCTTCAGTAACCCTGTGACGACTCCGTGTG
GACACAGTTTCTGTAAAGCGTGTCTGCGTGTTTACTGGAG
CCGTAGCGGTTCAGACGAGTGTCCGCTCTGCCGGAAGGCC
TTCGGCTCCAGACCGCGCCTCAGCGTCAACCGCATACTGG
CTGACGTCACTGAGAACTACAGAAAAACACGCCTGGCTGC
CAAATCCAAGTTCTTCAGTATGGATGAACTTCAAGATGAG
CCCAAGAATGAGGGAGAGGTGGAGCAAATGATCCAGGAAA
GAGTTCAGAAGATTGAGAAACTTCAGAATTCACTAAAGCT
AGTGAAGAGCACATGTCTCCGTGAAGTTCAGGAGAGTCAG
AGGGTGTTTTCCAATTTGCTTAGTACATTAGAGAAGAGCC
ATAAACTGGTCGTGACTGCAGTTGAACAGAAACAAAGAGA
AGCAGAGAAAAGAGTCGAAAGACTTGTAAAAAGCCTGGAA
AAAGAAATCCTTGAGCTGGAAAATGGACAATCCAATCTAG
AGCACCTGAATGACATGGAGCGTCTTAAAAAGGTCACTGA
CAACATCAGTTTTTTTTTTTTTTTTATCTGTAATTGTTAC
CATAGAAAACATTTATTGGAATAAATTGATATATTTGACT
TGACCATTATAGGTTATCATTTTTGCCTTACTATATGCAT
AATATTTGAATACATTCAGTAATTGAGAAATAGTTTTCTC
ATCCTAATGCTGTTCAAAACCTCTACACTCTGATAATTTT
AATAAAATATTATGAAAACCTGAAAAAAATGTATGCAGCT
GTATTCACAGTCAATATTTTACGTCTCTTCTAAAAAAATA
TTAAAGAATTTGAGTATTACTTAAGTAGGATTAAGTAAAA
ATAATTGTTGTCCTTAATCTGCAGAGCTTCAGTCACATAC
CTCGGCCAATGAGAGACTGGTCTAAAGTCATTCTGGAGAC
TGACCCTTGTGTTGGCTTCACCCGACAGACTGTGACTGAC
TTCATGGATACAGTGACGATGGAAGCTAAAAGACTTTCAA
AAACTGAACTCAAGAGGTTGCAGAAATATTCAGTTGATGT
GAATCTGAATCCTCGGACAGCTCATGCTTACCTCTACATC
TCTGAGGATCGGAAGGAGGTCAGGCATGCAAATAAGCAAC
AAGAAGTTCCAGAAAACCCCAAGAGGTTTGACCGGGTGAT
CAATGTCATGTCCAAGGAAGCTTTTCGCTATGGCAGACAC
CTTTGGGAAGTGGATGTTGGAGATAAGACTGACTGGGATT
TGGGGGTAGCCAAACAATCTGTCAACAGGAAAGGAAAATT
CACAATATGTCCATCCAATGGTTTCTGGACGCTCAGTTTA
AAGAATGGCTCTCAGTATGTCGCAAACACATACCCTCCGA
CTTCCTTCAACCTCAGTCACAAGCCTAAAAGGGTGTCCAT
TTACCTGGACTATGATGAGGGACGCGTATCTTTCTATTGT
TCGGATACTGGGACTCATATCTACTCTTTCAGAGACAGTT
TCACAGATAAGCTCCACCCTATCCTCAGCCCAGGACGACC
CCATGGAGAGAAGAACACTGCTCCCCTTATCATCAGCAGC
AGCTGCTGCAGCATCTGAACAATCTGCTGCCACTACAGCT
TTCACTTTCTCTCCCACTACCATTGCAACATATAGTTGTC
TGTTATTATTAAACTTATATCTTTTATTTATTATTGTTAT
TACTTTTTAATTACTATTTACATGAAGCATACCTCAAACT
GTGATCTTTTTTTAGCACATATCAGCTTTTTTTAATGATA
AGGATCATTTTCATGGCAACCCCTTTTAGCAAAAAGTTAA
TTTATTATATGAATATAACCATCATAACTTCTAAAAATGT
TTTGTAATATTGACAAAATAAAATTTTGACTTCTAAGTAA
A

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations