Transcript

btr02-201

ID
ZDB-TSCRIPT-090929-18485
Name
btr02-201
Previous Names
  • btr02-001
  • zgc:153136-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038093 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038093|OTTDARG00000028092|ZDB-GENE-060825-228 btr02|OTTDARP00000030529 DKEY-285G17.3-001 LG_none BX682554.3,BX682552.9 Danio rerio protein_coding KNOWN, 1488 bp
TTGTGGTCTGATTCACTTTATGAAACTCACCATACTGAAA
GAGACAAGAGCGACTCACTACAAACACTAAAGGCACTACA
GGGATGGAGTCCACCCTCAGTCAACTGTCGGAGAAGCACT
TCTTGTGCTCTCTGTGTGAGGAGATCTTCAGTAACCCTGT
GACGACTCCGTGTGGACACAGTTTCTGTAAAGCGTGTCTG
CGTGTTTACTGGAGCCGTAGCGGTTCAGACGAGTGTCCGC
TCTGCCGGAAGGCCTTCGGCTCCAGACCGCGCCTCAGCGT
CAACCGCATACTGGCTGACGTCACTGAGAACTACAGAAAA
ACACGCCTGGCTGCCAAATCCAAGTTCTTCAGTATGGATG
AACTTCAAGATGAGCCCAAGAATGAGGGAGAGGTGGAGCA
AATGATCCAGGAAAGAGTTCAGAAGATTGAGAAACTTCAG
AATTCACTAAAGCTAGTGAAGAGCACATGTCTCCGTGAAG
TTCAGGAGAGTCAGAGGGTGTTTTCCAATTTGCTTAGTAC
ATTAGAGAAGAGCCATAAACTGGTCGTGACTGCAGTTGAA
CAGAAACAAAGAGAAGCAGAGAAAAGAGTCGAAAGACTTG
TAAAAAGCCTGGAAAAAGAAATCCTTGAGCTGGAAAATGG
ACAATCCAATCTAGAGCACCTGAATGACATGGAGCGTCTT
AAAAAGAGCTTCAGTCACATACCTCGGCCAATGAGAGACT
GGTCTAAAGTCATTCTGGAGACTGACCCTTGTGTTGGCTT
CACCCGACAGACTGTGACTGACTTCATGGATACAGTGACG
ATGGAAGCTAAAAGACTTTCAAAAACTGAACTCAAGAGGT
TGCAGAAATATTCAGTTGATGTGAATCTGAATCCTCGGAC
AGCTCATGCTTACCTCTACATCTCTGAGGATCGGAAGGAG
GTCAGGCATGCAAATAAGCAACAAGAAGTTCCAGAAAACC
CCAAGAGGTTTGACCGGGTGATCAATGTCATGTCCAAGGA
AGCTTTTCGCTATGGCAGACACCTTTGGGAAGTGGATGTT
GGAGATAAGACTGACTGGGATTTGGGGGTAGCCAAACAAT
CTGTCAACAGGAAAGGAAAATTCACAATATGTCCATCCAA
TGGTTTCTGGACGCTCAGTTTAAAGAATGGCTCTCAGTAT
GTCGCAAACACATACCCTCCGACTTCCTTCAACCTCAGTC
ACAAGCCTAAAAGGGTGTCCATTTACCTGGACTATGATGA
GGGACGCGTATCTTTCTATTGTTCGGATACTGGGACTCAT
ATCTACTCTTTCAGAGACAGTTTCACAGATAAGCTCCACC
CTATCCTCAGCCCAGGACGACCCCATGGAGAGAAGAACAC
TGCTCCCCTTATCATCAGCAGCAGCTGCTGCAGCATCTGA
ACAATCTGCTGCCACTACAGCTTTCACTTTCTCTCCCACT
ACCATTGCAACATATAGTTGTCTGTTATTATTAAACTTAT
ATCTTTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations