Transcript

alox5b.2-201

ID
ZDB-TSCRIPT-090929-18427
Name
alox5b.2-201
Previous Names
  • alox5b.2-001
  • zgc:136911-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038030 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038030|OTTDARG00000039692|ZDB-GENE-060623-19 alox5b.2|OTTDARP00000030479 alox5a-001 LG_ BX000999.10 Danio rerio protein_coding KNOWN, 2358 bp
CTAATTTGTAATAGTTTCCTGGACGGGATTGAAGCATATT
CAGAGGCATCGTCTGGAGTCTGAGCTGCAGCAGAATGTTC
ACGTACACAGTGTCTGTCACGACTGGAAACCAAGTGTTTG
CTGGGACTCTGAACTACATCTACCTGACGCTGGTGGGCAA
AGAGAGAAGCAGCGACCGAACTCTGCTGGACAAATCCTGG
TTTGAACGTTTGGACAGAGGAACGGTGGTTTCCATTGACA
TCCATGTGGAGGAGACTCTTGGAGAGCTTCTGCTGGTCAA
ACTGGAGAAGGAGAAGTTCCTGATCAATGATGATTGGTAC
TGCAGGAGCATCAGTGTAACAGCACCCACTGGAGACTGCT
TCGAGTTCCCCTGTTATCGGTGGATAGCTGATCAAAAGGA
GCTGGTTCTTCCAGAAGGACGGGGTCGATTGCCTCAAGAT
GAAAAGCTCTCAATACTGAAAGAGTGCAGGCACCTGGAAC
TGGAAAACAGACGAGAAAAGTTCAGGTGGAATGAGTGGAA
ATCTGGCTTCCTAATGTCCATAGATGCCAATAAGTCCTCT
GAACTTCCTCTGGATGTTCAGTTTGATACAGCAAAAGCAG
TGGACTTCTCTTTGAATGCCTTTAAAGCAGCTGAGAATCT
TGGACTTAATAAACTTGAGAGTTTGTTCCAGTCTTGGAAA
GATTTTGCAGATTTTGAAAAAGTATTCATAACCATCAAGA
ACACAGAGTCAGAGTATGTGATGCAGAACTGGACTAAAGA
TGCTGTGTTTGGTTATCAGTTCTTAAATGGCTGCAATCCT
GTGATGATCAAAAAGTGCACAAAACTTCCAGACAAGTTTG
CTGTAACGCAGGAGATGGTGGAGAACTCCCTGGATAGAGG
AACCACACTGCAGGAGGAATTAAAGGCAGGAAACATCTAC
ATAGCAGACTATGAAATACTGGAGGACGTGCAACCCAATG
ACACAGACCCCAGCACCCAGCAGTATTTGGCCACCCCCTT
CTGCCTGTTTTACAAGAATGGACAAAATGAATTTATACCA
ATCGCTATTCAGCTCAGTCGTCAGACGACTCCAGGAGAGA
TGAACACAGTCTTTCTTCCCACTGACGATGAGTATGACTG
GTTGTTGGCCAAAATGTGGGTGAAATCCTCCGACTACAAC
GTACACCAGCTGGTCACACACCTTCTCAGGACACACCTGA
TATCTGAGGTGTTTACCATAGCCATGTTCAGACAGCTCTC
CGCTGTCCACCCTGTGTACAAGTTACTGATCCCTCATGTC
CGTTTCACCATTGCCATCAACACTGCAGCACGGGAAACAC
TCATCAATGAGGGTGGAGTCTTTGGAAAGGTTGATAGCAC
TGGTGGAATTGGAATTGAGCAAGTGATCCGAAAGGGTATG
CAGACATTAACCTATAAGTCCCTGTGCTTCCCTGAGGCCA
TGAAAATTCGAAATGTTGATAACAAGGAAGATCTGCCAAA
CTACTACTACAGAGATGATGGCATGATGGTCTGGGAGGCA
GTGAAAATCTTTGTTTCTGATGTGGTCAAATTCTACTATA
GTAGTGATGAGACCGTTCAGGAAGATGAGGAGATCCAGGC
CTTTGTTCAGGATGTTTGCTCCTATGGTATGAAGAATTGC
CCCAATAACGGTGAATTTCCGAATGCCCTGAAAACCCGGG
AGCAGTTGGTTGAGTATCTGACCATCGTGATTTTCACAGC
TTCAGCACAACATGCAGCAATCAACTTTGGACAGTTTGAC
TGGTATGCCTGGATCCCGAACACTCCGTCCACCATGCGGA
AACCTCCTCCCATAGAGAAAGGCAAAGTGGATATGAAGTA
CATCATGGAGAGTCTGCCAGACCACGGACGCTCCAGTTTG
CATCTAGGAACAATTTGGATCCTCAGTCAGTTCCAGGACA
ACGAGCTGTTTTTAGGCGTGTACCCAGATAAGTACTTCAC
TGAAGAACCAGCCATGGAAGCAATTAAGAATTTCCGCAAG
AAATTAGTTGACGTCACTAAGACCATCAGGAGACGAAATG
AAACTCTGGAACTGCCCTACTGGTATCTGTGTCCAGACAG
AATCCCCAACAGCGTGGCCATCTGAAGAAAGCATCTGTGG
CAAACATTTACAAAAGCTGTTCACAGTGCAATTACACAGT
AATGCTTAGCACTCAATAAAAAGGCAGCAAGTTCATTTAA
CGCAACAGGAAAATGTTTTAAAACAGTGATTTTTAATTGA
TGTTTCAAATTCTTTGTTCATTAACACTTATTGGATTTGT
GGTTAATAAGTCAAAGCTCTGAAATACAATTAAGATCATT
CAATAAAGTACTTACAAACTACAATAATCTACCCATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations