header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18218
Transcript Name: bbc3-201
Previous Name: bbc3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037821 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037821|OTTDARG00000027940|ZDB-GENE-070119-4 bbc3|OTTDARP00000030314 bbc3-001 LG_none CR855332.7,CR848814.7 Danio rerio protein_coding KNOWN, 3808 bp
GCAGGCTAACTGAGTACTCATCTAATGAATTAACACCGCT
TTATATCCCCTCCAGCTTAAGGAATAACATGAACGGACAT
TTCAAGTGTTTCTGAAGTACGACACACATCTGGTGTCAGG
ACATCACGATTCTGGGATAACATCAACTTACTAACATCAC
CTTTTGAAGACTGTATGTGGAATGGCCCGACCAGAGATGG
AAAGCAGAGTGGACGAACATAACTCTGGCACGCCGAACAG
CTGCAGGATGGAGGTGCTGCGTCAGGACGCCTGGCCAAAT
GGCAGCATCATCCAGCCCTGCCATCGACGCCGAACCATTG
CCACTCAAACCAGCACTCTCTCTGCACCACTGCCCCACAT
CCCCTCACATGATGCCTTCAGCTTGGACAGCGTCCAGCAG
CAGGACAGTCTACTCAGGGACAATTCAGGAACAGAACAGG
AAGTGTCCAGGCCTCTTCCTCTGCCAGATCTGCTAGCAGA
CAACCAGAGCTCCTCAGAGGAGTCCACGTCCAGCAGCAGC
TCGACCGCTGAGGAGGACCCCACACTGGAGGAGCAGGCTG
TGGAGAGGGTGGCCGTACAACTGAGGACAATTGGGGACGA
GATGAACGCTGTCTTCCTTCAGAGGAATGCCGTCCCGCAC
TGGCAGAACTGGAGAGGCCTGTACCGCGGGCTCATGGCGC
TGGTCTCGGACACCATCAATGCCCTCTACCAGCACGGCCT
CAGATGAACACACGGGTTACAAAGGACAGGACGAGTGCAG
GCGCTCTCCTTTCCAACACTTACAGACTCTGGGATTTTTC
TGCAGGATCAGACGCCATGTTTGTTTCTTTATCTGTGTTT
GTTTTTTTGTTTTTTTTCATAAATGTAGCATATAGTGACT
GAAGCGTGTGTCCCGGGATAGACGTCAGTTAGGAGTAAGT
GGCGAATTAGTGAACTCATTTTTGCATTTTTAACTGGAGT
GCTGGAAGTTACATGATACCGGGTCACTCTCAAACAAACA
CACTGAGCCTAGAAGTGCTTTATGGGTAATGGGTTTTCCT
CTCCGCTGCCTTACAGGAGCAATAACTGCGCTGCACTATC
AGTCATCAACAGCGCAGGACAAGCACTCGCACAATATTGA
AATCTCAATTCTGTCATCGTTTACGCACCTCTAATTTTCA
TTCAACACTCGTAAATTTGTTCATTTGCTGAACACGTGAA
ATATTATCATTATCAATATTTTACTCTAACCATAGTGTAG
GATATATGATACTCTTTCCTCTTGTAATTTGAAAATTCAG
GAACAACAACAATAAAAACTGGCAGTGTATCATTAATGAA
TTCAATAATGAAAACATTAAAGGCTTTGCAATGTAAACTC
GGAAAAAATCTGTTAATTGAGTATTTTGTGATTCATGTTT
TTTTACCCATTATTACTCATTTAGGCTTTTCAATTGCATT
ATGGGATCTTGATCTTTCCTCCAAAAGCTTTTGATGTTGA
TTTTTTTTAAATGGTCTTTTATTGATATTTTTTCACAATT
CAAATGGATATATTGTCTAGGCTTGTGTTGTAAATTACGG
TACAAAAACCTGGCAATAAGCAGCCAGTACATTTTCTGTT
ATTAAAAAAACTAACTTATCTATTTATGATTTCTTAAACA
ATATCTTGTCTCTAACTACTTAAAATGTCAGTAAAACTCA
CTCTGTTAAAACTCCAGAGTTGAATTTTCAACATCAAAAG
TCAGAGCAGAGATCAACATCTCATAATTCAATTCACAACC
GTAAATAAACAGAAAATGTGTGAATCACAAAATTGTATTT
ACAGATATGTTTACAGTGTACGTCAAAACATTGACTAATA
TCCACCCATTCGACCATTTAATACAGGCTCATGGGAAACA
CTAATATGCTCAGTTTCCTTAAGTCAAAAATAAAATCTAT
AGTAAGTTTTCGCTATCTTTGACCTCTTTTTTTATGAAGC
CAGTCTCAAATATAATACATTTACAAGATATAATTCATAC
ATCCACAACACAATTCACATTTACAAAATTACAATTCGTA
AATTTAAAACACAATACAAAAACACACTAATACAATTCGT
AAATTCAAAACACGTTCATTTTCAGAACACATGGATGAAA
ATATTTTAGACTGAATCTGAGATTTCAGCCCCTTCACTTT
TACTGAAAATGCATTTTTCTGAAGAAATTGGAGTTTTTTT
TAATGATGAACAGATTTAATTTAGGTTTATATATTCACAT
ATAAACACTGAACTGCAAACAATGTTTACAGCTTGCTTCA
CATGCAAGAATCAATGCGTTAATAATATAAATAAAAGCAT
AAATTCAATCAGGTCATCATGTAAATCCCCCGTAGAATAC
CTCAATACATCATTCATTTCTAATTCCTTTGAAAATGAAT
AGATTTACGGTTACAGAAGTGTCTCAGATTGCATTAAAAA
GATCTTCCGAAGCTTGAGGGTGAGTATATACGATGACATA
ATTGATTTTCTAAAGCGAACCCTTTTAATGGTAAACGGGT
GATATTTACTGCAGTAATGGAACGTGTGTGTACTTTTTAA
TGGAGCACAGTTGGATCGTGCCTTGCGAACACCCTTTTTG
TACTAAAGCCATTAGGGACAATCATTGAATAGTGTGCGGG
TTAACCCATACTGTCGCCCCCTAGCTGAATCTAAACTTCG
GGACACAGATTTGCCACTTAATTTAAAGACTGGTCGCCTC
CAATGGAGGCAAAGGAGAAAGCCAGACCACTAGTAATGGA
AATGGCTGGAGAGCAGTGTTAATATTTGCAAGTGTACATA
TTTTGAGGATAGAATAAACAGGGAGTTTTTTGGTTTCTTA
TGTGGTTTCTATATTTTGATGAAATGACCTTAAAGTACTT
AACATTAAGTTCCTTTTTCGGTTTCAGTTTGGTTTCGTTA
TATGAGCTTTATTTTTTGGGGGGCCGACACTGGAATGCAG
TTGTTTTCAAGTCCAGTGGATTTCTGTCTGTTTCTGGAAC
TTAATTAAATATATCGTGTAAAAATAAGTGAGCACCCCTC
TCCCCATGATAAAAATGTACTTTGCGAATTGAGTTCTCAA
ACAAATATATTTGAGAAGCACAAGCTAATTTATTGAGCGT
CCATTTGTTATAGGCGGAACTGAAGTGGATTGAATAAGCA
TGGAGATCTTCATTAGTGTTGTGTTCCTATGGACCAAATC
TCTCTGTCGTTTATTTGTTGACATTCCCCTGAAGGTTGTA
AGAACAATCCATTCATTTCCTGTTTTTTTTTCTTTCATTC
TGCTGTAATTTATTTGTCTACAAAAAGGACTAAACTGAGC
CAAACTTTGATCATACTTGAACAGACTGAATCATCGTGTC
AGATCCAGGTCTGTCTGGGACTTTTACAGATACGTAACAC
TGTTATGGGTTTCAAGCACTTCCCTTAGAAACCACTTTTG
AACAACTGTGGCCGGTCGGTGTGTAAACTCCTTCAACCAC
TCATTTCTGTGTTTGCGTCGGCTTCTGTAGTGTCGGTCAT
GGCATGTTGTGGAGCAGAGATGTGTTTCCTGTGGCCGCTT
GTCTCATGACTTCCTGTTTAACAACAGTTGTGTGGTCTGT
TTCCTGTGGCCACCTTGTGACTTTCAACCAAACTGTTCGC
TGATGCGGAAAGGCCTTATTTGTACTGTCAGATTTACACT
AAACTCATGACTCATTTTCTAGCTTTGTACTTTTGCCATT
TGAAATTTTTCTATGTAAAATTTCTACATGAATTTTTGTA
TAGTTTTTTTTTTCTTCACCGTTTTCAATAAATATGACAA
TTACAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bbc3-201 Contained in:

OTHER bbc3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037821 (1)
  • Ensembl_Trans:ENSDART00000137918 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC139508 (1) 3791 bp
    GenBank:DQ860151 (1) 894 bp
    CITATIONS (2)