header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18215
Transcript Name: rad1-201
Previous Name: rad1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037818 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037818|OTTDARG00000027938|ZDB-GENE-040426-1873 rad1|OTTDARP00000030312 rad1-001 LG_ CR848814.7 Danio rerio protein_coding KNOWN, 1653 bp
CTGCATCAGACCCATATGCGCGCGCGAGACAACTGATGGG
AAGCTAAACTTAGTCAAAATCACAAGAAGAAGAGCTAATG
GCAACAATTTAAGGGCGCCAAACTCTAAAATGATATTAAT
TTGTCATATTTCATATATCTAACAGATGTAATAACATGCC
TCTGTCAACTCAGTCCCAATCCGATGTTGACCAGTACATC
CTGATAGCCAGTTTGGACAATGCAAGGAATCTGTCCAACA
TCCTAAAAGCCATCTCTTTCAAGGATCATGCCATCTTCAA
TGCAACACAGAATGGGTTGAAAGTCACAGTTGAGGACTCC
AAATGCCTTCAGGCCAATGCATTCATTCAGGCTGACATCT
TTCAAGAATACATCATCAAAGAGGATGCAGTTGGCTTTCA
GGTTAACTTAACTGTTCTTCTCGATTGCCTCACCATCTTC
GGGGGAAGCACAGTGCCAGGTGTGTGCACCGCCTTGAGAA
TGTGCTACAATGGATATGGATATCCACTAACTTTGTTCCT
GGAAGAAGGTGGTGTGGTCACTGTATGCAAGATTAACACA
CAGGAGCCCGAGGAGCCCATAGACTTTGACTTTTGCAGTA
CAAACGTGACCAACAAGGTGATTCTGCAGTCGGACAGTCT
TAAAGAGGCTTTCTCTGAGCTGGACATGACCAGTGAGGTT
CTGCAGATTACCATGTCACCGAGCCATCCTTACTTCAGAT
TATCCACATTTGGTAATTCTGGAAATGCCCATTATGATTA
TCCCAAGGACTCAGACATGATGGAGCTGTTCCAGTGTACA
AAAATACAGACCAACAGGTATAAGATGTCCCTGTTGAAAC
CGTCCACAAAAGCCTTGGCCCTGTCCTGTAAAGTGTCGGT
CAGAACTGACAGTCGAGGCTTCCTCTCTCTACAGTATCTC
GTGAGGAATGACGACGGTCAGATTTGTTTTGTGGAGTACT
ACTGCTGCCCGGATGAAGAAGTGGAGGAGGAATAGGTTCA
TGCATGATGATCTCCTTTTTTAGGTTTAATAATGTATATA
GTTTGTCCTGCACTAATGTTATCATTTATTAAAAATAAAA
TATAAAGTAATGTCATAAACCAAATAAACTTCTATCATTG
AAGAGATAGTTCATCCTAAAAGAAAAATGTACTTTCCAAT
TTACTCACCCTCAAGTGTTTCTGTTTTTAAAACATAAAAA
GATATTTTGAAGAATGTTGAAAATTAGTAGACAACTGGAA
TCTTCTAGTTTCCAAGATTTTTTTTACAATTTTCAGTTGC
ATTTAACTGAGGAAAGAAATTTAAATATGGTGGAACAAGT
TGAAAGTGAATGAATGATGACAGATTAATTATTTAGGGTG
AATTATCCCTTTAATTAGAAACATTCTATTAAGTTTGGAC
GATTCCCTGTGTGATCGGCAGGGGGCGCGAGGGAATTGTA
TGTTAGGCTTTTACTGGAGCAGCCTGATGTTTTAATAAAT
ATGAAATATATATGTTAAAAATAGACATGTTTTCAATTCT
GCTTTTAGTATTCTCCTAAATATGTGTCTGTGTATTCACA
TTTTATGAATGTTCCAGCCCACAAAGTACAATTTCAATTG
TTCCTTGTATATTTACAGTCATCTAAATGATTAGAATACA
ACAAATAAGTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rad1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037818 (1),  Ensembl_Trans:ENSDART00000059354 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC064305 (1) 1624 bp
GenBank:BC049464 (1) 1612 bp
GenBank:CK028532 (1) 818 bp
CITATIONS (2)