Transcript

nek8-201

ID
ZDB-TSCRIPT-090929-18194
Name
nek8-201
Previous Names
  • nek8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037794 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037794|OTTDARG00000027921|ZDB-GENE-020509-1 nek8|OTTDARP00000030293 nek8-001 LG_ CR855391.6 Danio rerio protein_coding KNOWN, 2784 bp
GTTTTGGAGCCAGCGAAAACATGGAGAAGTATGAGAAGAT
TAAAGTGGTCGGCAGAGGAGCTTTCGGGATCGTGCACCTC
TGTCGCAGACGCACTGATAGTGCGCTGGTGATCTTGAAGG
AGATTCCCGTCGAGCAGATGACCCGTGATGAACGTCTGGC
AGCTCAGAATGAATGCCAAGTCCTCAAGCTTCTCAGCCAC
CCCAACATTATTGAGTACTATGAAAACTTCCTGGAGGACA
AGGCACTAATGATCGCAATGGAGTACGCCCCAGGTGGAAC
TCTGGCTGATTACATACAGAAGCGCTGCAACTCCCTGTTG
GATGAGGACACTATTTTACATTTCTTTGTTCAGATCTTAC
TGGCCCTTTATCATGTACACAACAAACTCATCCTACATCG
AGACCTAAAAACCCAGAACATCCTCCTGGACAAGCACCAG
ATGATTGTCAAAATAGGAGATTTCGGGATCTCCAAGATCC
TCGTCAGCAAAAGCAAAGCTTATACTGTTGTTGGGACGCC
GTGTTATATCTCTCCGGAACTGTGTGAGGGAAAGCCATAC
AACCAGAAGAGCGACATTTGGGCCCTCGGCTGTGTGCTTT
ATGAGCTTGCTAGTCTCAAGAGAGCCTTTGAAGCAGCGAA
CCTGCCAGCCTTGGTGCTGAAGATCATGAGTGGCACATTT
GCCCCCATATCAGATCGTTACAGTCCTGAGTTGAGACAGC
TGATTCTCAACATGCTGAATCTAGACCCATCCAAAAGGCC
CCAGCTCAATGAGATAATGGCTCACGCCATCTGCATCAGG
CCTCTGCTCAATCTCTACACTGACATCGGCAATGTCAAAA
TGCGCAGAATAGAAAAGCCACTTTCTAATGTACAAGCAGG
CCCTCATGGCAGACCTGGTGGTTGGATAACCAGTACCAGA
ACCAGAGGAGGTCTGTCCAGTCTGACGTCCTCAAAGATGA
TGCACCCGCTGCCTTTATCCTCAGTCTACACCTGGGGCAG
TGGCATTTCAACTCCCCTGCGTCTGTCCATGTTAAACACT
GAGGTCATTCAAGTGTCTCTGGGACGCACACAGAAGATGG
GAGTCACCAAATCAGGGAGGCTCATCACATGGGAGGCGCC
CTCGGTTGGATCCGGTGAGCCCACTCTGCCTGGCGCTGTT
GAGCAGATGCAGCCCCAGTTCATCTCCCGCTTCCTAGAGG
GCCAGTCTGGAGTCACCATCAAATCTGTGTCCTGTGGAGA
CCTCTTCACCACCTGCCTAACAGATAGAGGTATAATCATG
ACGTTTGGAAGTGGAAGCAATGGTTGTCTTGGACATGGGA
ACTTTAATGATGTGACACAGCCCAAGATAGTGGAGGCTCT
GCTGGGTTATGAGCTGGTTCAAGTGTCTTGTGGAGCATCC
CACGTCCTGGCAGTGACCAACGAGCGAGAGGTTTTCTCCT
GGGGCCGAGGAGACAACGGCCGGCTCGGTTTGGCCACTCA
GGATAGCCACAACTGCCCACAGCAGGTGAGTTTGCCAGCA
GATTTCGAAGCCCAGCGCGTGTTGTGTGGCGTCGACTGCT
CCATGATCATGAGCACACAGCACCAGATCCTCGCCTGTGG
GAACAACAGATTTAACAAGCTGGGTTTGGATAAAGTCTCA
GGGACGGAGGAACCCTCGTCTTTCTGTCAGGTGGAGGAGG
TTCATCTGTTTCAGCTCGTCCAGTCGGCTCCTCTGAACAC
AGAGAAGATCGTGTATATAGACATCGGCACAGCACACTCT
GTCGCAGTCACAGAAAAAGGTCAGTGTTTCACCTTTGGCA
GTAACCAGCATGGACAGCTTGGCTGCAGTCACCGCAGAAG
CAGTCGAGTGCCGTATCAGGTGTCGGGCCTGCAGGGCATC
ACGATGGCTGCGTGTGGTGATGCCTTCACTCTGGCTATTG
GAGCAGAGGGTGAAGTGTACACTTGGGGTAAAGGCGCGCG
CGGTCGACTCGGGAGGAAAGAGGAGGATTCTGGGATACCA
AAACCAGTGCAGCTCGACGAGAGCCATGCTTTCACTGTCA
CCTCAGTGGCTTGTTGCCATGGAAACACTCTACTGGCTGT
GAAACCATTTTTTGAAGAGCCTGGACCAAAGTGACATGAC
TCTGCCTCTGTCCAGATGAACATCAGAGCCTGCAGTAGAC
TTCACTCGACTTCGGTTTATCAGGAAACCATAGTGGGTTA
TGGATAGTTCACAGTCATCATTTATTCACACTTGACTTGT
TCCAAACCTGTTTGAGTTTCTTACTTCTGTTAAACATAAA
GGAAGATATTCTGAAGAATGTTGTGCACCTGTAACCATTG
ACTGTAAAACAAATACTATGAAAGTCAATGGTTACAGGTT
TACAACATTCTTCAAATGATCTTATTTTGTGTTCAACAGA
ACAAAACATGTTTGGAACAAGTGAAGGGTGAGTAAAAGAT
GACAGAATTTTTGTATTTGGATGAACTATCCCATTAACAG
GAAATTCAAGCCAAGCTGTTGTGTTTATGACATGATATGA
TGCAAAGATAAGCATTTTTTTACTGACAAAATGTAAATAC
TAACTTAAGACAGCAGAATTGTTCAAATTCTGTATTTGCA
GTATTACATCTTATGTGTGAAGAAAAGTGTACTGAACTAA
GTTTACAATAACATTATTAGTAATGAGAGTGTAGTATTGT
AAATAATGCCTTATTCCTGGCTGTGGCAAGAAAAAACTGT
ACAAATATTTTATATAATTTAGTAATAAAGTGCTGCTTAT
GAAAATGAATAAAATAAATAGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations