Transcript

slc17a5-201

ID
ZDB-TSCRIPT-090929-18038
Name
slc17a5-201
Previous Names
  • slc17a5-001
  • zgc:153077-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037635 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037635|OTTDARG00000027818|ZDB-GENE-060929-1158 slc17a5|OTTDARP00000030164 DKEY-187A12.2-001 LG_ BX323884.5 Danio rerio protein_coding KNOWN, 2202 bp
GGTGAAGCACGGGTTTGGTTTTGCGTTGACACTGGAGTGT
GTTGTTGTTCTTCTGACCGGCGGGGATGATGGAGCTTTCA
GCATCAGACTCTGAATCTGAAGATCATGCCCAACCTTTAC
TTCGCCGGAAAGACACCGAAGACATCCAGAAAGCACCTGC
ATGTGGCTCCTCTCGATACGGGTTGGCGTTTTTGTCGTGT
TATGGCTTCTTTGTGGCATATGCCCTCAGGGTGAACCTTA
GTGTGGCGATGGTGGACATGCTGAAAAACAGTTCAAAAGC
AAACACCAGTTCCTCCATCTGCCCTCCTCACAACATCCCT
GTACCCAAACACAATCACACCGCCATGGTATACGACTGGA
ACTCAGAGACTCAGGGCTGGATCCTGGGCTCTTTTTTCTA
TGGATATATAATTACTCAGATACCAGGTGGTTACTTGGCG
CGCAAGTATGGTGCCAAGTGGCTTTTGGGTCTTGGCATCC
TCTGCACTGTGATCTTTACTCTGCTGACTCCGTTAGCTGC
TGATTTGGGAGCAGGATACCTCATCGCTGTCAGGGTGCTG
GAAGGCATTGGGGAGGGAGTGACATATCCTGCAATGCATG
CAATGTGGGCTTCATGGGCTCCACCTCTGGAGAGAAGTCG
ACTGCTCACTATATCTTACACAGGTGCTCAGCTTGGAACT
GTAGTGGCCCTTCCTCTTTCTGGACAGATCTGTTTTTATC
TAGACTGGACATATGTGTTTTATATATTTGGAGCTGTTGG
CCTTCTTTGGTTTTTCCTTTGGATTTGTTTCGTCAGTAAC
AGTCCCAGCTCACACAAAAGAATCACAGAGGCTGAAAAGA
CCTACATAATGTCATCTTTAAAGAATGAACTGTCCCCCAC
CCAAGATTACATCCCATGGACATCAATCTTCAAGTCTATG
CCTTTATGGGCAATAGTTGTGGCACATTTCTCTTACAACT
GGACCTTCTATACTCTTCTGACTCTTTTACCCACCTACAT
GAATGATGTTCTCGGCTTCAGCATTCAGCAGAACGGGATG
CTCTCGGCTCTGCCTTATCTTGGTTGTTGGCTGCTGGCTT
TGCTGGGTGGTCAATTGGCAGACCTCCTGAGAGAGAGGTT
TCTTTTCCGCACCGTCATTGTGCGCAAGGCTTTCACTGTA
GTAGGAATGGCAGGACCAGCCGTCTTCCTGGTGGCTGCAG
GATACACTGGCTGTAACTACATCCTGGCTGTGGCCTTCCT
CACCATCTCTTCCTCCCTAGGAGGAATTTCAGCCTCTGGA
TTTAACATCAACCATCTGGACATTGCTCCCTCTTATGCTG
GAATTTTGCTGGGAATTACAAACTCATTTGCCACTATACC
TGGCATGGTCGGCCCTGTAATAGCGAGATCTCTGACCAAA
TCTAACACTATTCCGGAGTGGCAAATTGTCTTCTACATTT
CTGCAGCAATTAATATTTTTGGAGCCGTTTTCTTCACAAT
ATTTGGCAAGGGTACAGTCCAGCCTTGGGCTGTCCAGACA
ATACACATCCAGTGACACTTGACTACGGTTAGCCAATTCT
TAAAGGCCAAAGGGATGTATGTACTTTAAATTCCATAGAG
ATTTATAGGTAATTGCATATGGTTTACAAACTAATGAGTA
TTGCACAATCTATGTTTTAATGAGTTAAATTGAGCTATTT
TATATTGGTAATATCTGTATTAGTTGTAAATGTCAGTTGT
TTAGACAATTTTTTTAATGAAACTGTAAATGAAGGGAATA
TACATAAGTGTCTTTATGGTACAATTGGCCATCATAAGGA
GATAAAGGGTTTGACTACACAACCTCAAACGAGTCCCTGA
ATTAACCATTTATGTAGGGCACTCATTAAAATACTCAGTG
GAAAAATTCTGGAGTGTTACTGGGAGTTGATACAAGACTT
CTGAACTTGCATAAATGATATTGTACGCAATGTCATTGAA
GTGGAACCCACACAGCAGGCACTGGACGTCAACATGACGT
TGTACCCCAATGTCATGGGGATGTTGTATTTTGTTTGGAA
TGAAAATCAGGTTGATGTCAGAACCCAACATCAGGCCAAC
ATCGGTGTTCAACCTAAAATCAACCAAATATCAACATCTA
ATGAAGTCACCACTTTGACATATATCTGACGTTGGATTTT
GGTTGCCATTCCTGATGAATAAATGTCAGTATTTGACTTC
AA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations