Transcript

hcrtr2-201

ID
ZDB-TSCRIPT-090929-17989
Name
hcrtr2-201
Previous Names
  • hcrtr2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037585 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037585|OTTDARG00000027794|ZDB-GENE-070228-3 hcrtr2|OTTDARP00000030123 hcrtr2-001 LG_ CT009597.24 Danio rerio protein_coding KNOWN, 1317 bp
TATCGGAGATGCGCGATGCTGGATCGGGCTTTCGGCGCAA
ACATGTCCGGGATCTCCGTCCAGCGCGCCTGCAACTCCTG
CTTCACCTCAGCCCAGCACCTCAACTCCTCCGCGGACACA
ATCTCGCATTCCCACGCGGAAAACGAAGACGACGAGCTCC
TCAAGTACATCTGGAGGGAATACCTGCATCCCAAACAATA
CGAATGGGTGCTCATAGCTGGATATATACTGGTTTTCCTC
GTGTCTCTGGTCGGAAACACACTGGTTTGTTTTGCAGTTT
GGAAAAACCATCACATGCGGACAGTGACCAACTACTTCAT
CGTGAACCTGTCCTTCGCAGACATCCTGGTCACCATCACG
TGTCTTCCTGCAAGTCTTGTGGTGGACATCACCGAAACAT
GGTTCTTCGGACAGACCCTGTGCAAAATACTGCCTTACCT
ACAGACCATCTCAGTGTCCGTATCGGTCCTGACACTGAGC
TGCATTGCCCAGGACCGCTGGTATGCGATCTGCCACCCGC
TAAAATTCAAAAGCACTGCTAAAAGAGCCCGCAAGAGCAT
CGTGCTGATCTGGCTGGTGTCCTGCATCATGATGATCCCC
CAGGCCGTGGTGATGGAGAGCAGCAGCCTGATGCCGGAGC
TCACCAACAAAACCAGCCTGTTCACCGTCTGTGATGAGCA
GTGGCCAGATGAAATCTATCCTAAAGTCTACCACACCTGC
TTCTTCATCGTCACTTATTTCGCTCCACTGTGTTTGATGG
TCCTGGCATACATTCAAATCTGCCATAAACTCTGGTGTCA
ACAGATTCCAGGGTCGTCTTCGGTCCTCCAGAGGCAGTGG
AAGTCTCTGCAGTGTTCGGCTCATGCGGTCGGGTCTGGAG
AATCGGTGAAGGTGAGAACCAGCACAGTGTCAGCGGAGGC
CAAGCAGGTGAAAGCCCGGCGGAAAACTGCACGGATGCTG
ATGGTGGTGCTGTTTGTGTTCGCCCTCTGCTACCTGCCCA
TCAGCATCCTCAACATCATGAAGAGAGTATTCGGCGCATT
CAAGAACACAGGCAACAGAGAGACTGTGTACGCCTGGTTC
ACCTTCTCCCACTGGCTCATATACGCCAACAGCGCCGCCA
ATCCAATCATCTACAATTTCCTCAGCGGCAAATTTCGAGA
GGAGTTTAAAGCAGCGTTCATCTGTCAGTGCTCGGGTCGA
GGAGAAACACACAAGCAGAGAGCGAGAGGCAGAACCAGCA
CAGACAGCCGAAAATCCCTGTCAACACAGGTCAACAACCT
CGACAACATCTCCAGGATTTCAGACCAGGCGGTGTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations