Transcript

flrt3-201

ID
ZDB-TSCRIPT-090929-17959
Name
flrt3-201
Previous Names
  • flrt3-001
  • si:dkeyp-24h12.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037550 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037550|OTTDARG00000027778|ZDB-GENE-030131-1988 flrt3|OTTDARP00000030096 DKEYP-24H12.1-001 LG_ BX465200.7 Danio rerio protein_coding KNOWN, 4225 bp
GCAGATGCAACCTCACACTTGTAGTGAGCTCTAGGCAGCT
GACCAGCTCTGCCGTCTTCTTTATCTTGTCTCTCTCTCTG
AGCCAAAGGAGTGTGTGCGCGTGTGTGTGTATGTGAACAA
GTGTGTGTGGAAATAAAAACACACCCTGCTATTCTCACCA
TTGCTGCTACTGAGCCTTTCTGACACCGGGCTCTTTTTGG
GAATTGAATTCATCTGCCGTCGCATTGGATTTATCCTACG
GACTGACTTTATTCTTTTGAGGATATTGTTTTTGATTTTT
CCCTTTTTGAAAATATTGATTTGGAAGGTATGAAGTTCAG
CATGTGGGAAGGAATGGGTGTCTGCACATCGGGCACAGGT
TTGTGAAACGAGCCAGGGAGGCAGAGTGCTTATAGCAGCA
CAGGAGATTCTGCTTTCAAGCCACGAGGCTGGATATTTTT
ATTCATGCTCTTGCCAGGAGTGAGACTACAGGATTCGGGC
CTGACTTTAGAGCCTGACTTTAGAACCGAGCCACCCTGGA
TTTGAGCCCACTGTACTGCAGACGGACAGTGGTCTTAACG
CCATGACCAGTCTGCTTTGGGAGAGACAGGAGCAATTCAC
TTCTCAAAGAGGACTCACAAAAGAGTCCAATTAGGAATTG
CAACTTTGAAAAGGATTCTGCTCTTTTTTTTATTTGCCTT
ATTTTTGTTTTATTCCTTTCTTTTGTGATTACACTCACTG
AAATTGCATGTCTGCCCTGAGAAGGCTGCCTGAGGTCTGG
CTGGAAGCAGAGCTGCTTGCTTTATAGGTTTATCTACCAT
GGCAAAGCCTTTGATTGCATGAACTGTGGACGCTGCAATA
CAAGACAGGAGGTCAGCGGTACAAACAAGGATCAGTTCAG
CAAATACCAGCCTGGTCAGGATATAACCAAAGAGACCCCT
TTGACAAGACGGACAAACATCTCTTGAAAGAATAGAAGGA
AGGGTGTAAAGCCTCATTGGATTTGGGGTGGCTGCAGAGG
ATTAGCTGGCATTTCTAAATCAGGGCAACATCTGCAAAGC
GGACATTAGCAATGGCAAGCAATTACATGTCCTTCTTCGT
CTTCTTCATCAGAGCTGGGCTTTTGCTTGGCCTGGCCAAT
CCATTGATGACCTCAGCCTCCTGTCCCTCTCAGTGCCGGT
GTGATGGGACTTTCATATATTGCAATGACCGGGACTTGAC
TTCCATCCCTTCAGGTATCCCAGAGGATGCTACGGTACTA
TTTCTCCAAAACAACCGCATCAAAAGTGCAGGGATTCCTA
CAGATCTACGAAGGCTAAATGGCGTTGAAAAGATTTACCT
ATACTGCAACAACCTGGATGAGTTCCCCACCAATTTGCCG
CTTAATGTCAAGGAACTTCATTTACAGGAGAACAATATCC
GGACTATCACACACGCCTCACTTGCACAGATTCCCTTCAT
TGAGGAATTACACCTTGATGACAATTCTGTTTCAGCTGTC
AGCATCGAAGAGGGTGCATTCCGGGACAGCAACCATTTGA
GGCTGCTTTTTCTGTCCCGCAACCACCTAAGCACCATACC
TTCCGGTTTGCCAATGACTATAGAGGAGCTTCGATTTGAT
GACAACCGCATCTCATCCATCTCAGAGGCATCTCTGCAGG
ACCTTATAAACCTGAAGCGACTGGTTCTGGATGGCAACCT
CCTGAACAACAGGGGCATCGGGGAGATGGCCTTGGTGAAT
TTAGTAAATCTGACCGAGCTCTCATTGGTACGAAACTCCC
TGACGTCCCCACCAGCCAACTTGCCTGGCTCAAGCCTAGA
GAAGCTAAATCTTCAAGACAACCACATCAATCACGTACCA
CCAGGTGCCTTTGCTTTTCTGCGACAGCTGTACCGCTTGG
ATTTGTCAGGCAACAACTTGAGCAGTCTGCCCATGGGGGT
ATTTGAGGACCTGGATAACCTTACCCAACTGCTCTTGCGC
AACAACCCCTGGCATTGCAACTGCAGGATGAAGTGGGTAC
GTGATTGGCTGCGCACTCTTCCATCTAAGGTCAATGTGCG
TGGCTTCATGTGCCAGGGTCCCGATAAGGTCAAAGGGATG
GCCATCAAAGACTTATCCACTGAGCTGTTTGGCTGTTCAG
ACACAGAGATTCCAACCACATACGAGACCAGCACAGTCTC
AAACACTTTGCCTCCCTCTCGACCCCAGTGGCCCTCATAT
GTAACTAAAAGACCTGTGGTTAAGGGTCCAGATCTAGGAA
GAAACTATCGTAGCACGACACCGTCTAGTCGTAAGATCAT
CACAATAAGTGTCAAATCAAGTAGCGCTGAGACAGTGCAC
ATATCTTGGAGAGTATCTCAGCCCATGACAGCCCTGAGGC
TCAGTTGGCTAAAGCTGGGCCATAGTCCAGCTTTTGGATC
CATAACTGAGACCATTGTCCAAGGGGAGAGAACAGAATAC
CTGCTTACAGCTCTGGAGCCAGAATCTTCTTATCGCATAT
GCATGGTTCCTATGGAGACGAGTAACATTTACCTGTCTGA
CGAGACACCTGTTTGCATAGAGACAGAAACTGGTTCCCTG
AAAGCCTACAATCCCACCACAACCTTGAACAGAGAGCAGG
AGAAAGAGCCTTACAAAAATTCCAATCTGCCTTTAGCTTC
AATTATCGGAGGGGCGGTGGCCCTTCTAGCCATCATCATG
TTGGCCCTGGTGTGCTGGTATGTCCACAGGAACGGTTCCT
TATTTTCTAGGAACTGCACGTACAACAAAGGGCGCAGACG
GAAGGACGATTATGCAGAAGCTGGAACAAAGAAGGACAAC
TCCATCTTGGAGATTAGAGAGACCTCTTTTCAAATGATTC
CCATAAATCACATGCCCGTTTCCAAGGAGGAATTTGTGAT
ACACACAATTTTTCCTCCAAATGGTTTAAGTCTTTACAAA
AGTCCGCACAGTGAAAACAGCATCAACAACAGAAGCTACA
GAGACAGTGGAATACCAGATTCAGACTACTCTCATTCATG
ATAGTGTGCGCGGATTACAAAGACATTTTATTGCGAATGA
GTGACTTGGAGACTGCTTGGTCTTTTGCAAAAACACTGGA
TTGAAAAGACTGAGAAAGCATCGTTATGTACATTTGCCAT
ATAATTTATATTTAAGGACAATTTATTAAAAGGAGAAAAG
GTTCTGATTGCAGGCCATCACTGAGCCATCAGTGTATGCT
GCCACAAACTGCAATTCTATATTTTAGATATTTGTAGTCA
TTTGTACTGTACTTCCTTTACTTATGGTTTTAGACCAATT
AAAAAAACTTTGTGCTCTACTGAGATATGATGACTTGTCA
ACTGTGAAAGTGGGTTTTCATTGCTGTGTTGAACAATCAG
ATTTTAGAAAACCATGTAGTATAAGCACAGGTCAAACTAT
CGCTATGTTGCTGTCAGTGGAAAAAAAATACAACAAAAAA
CAAGACTGCGGGAATATAGGGCATAGGTGATCAAAGAAAA
TACAGACACAAGTGTTTTGTTAACTCTAAGGAGAGGAGGC
ACATACTCACTCTTGTGGTGTCACAGAAACCTGTAGGTTT
CTCTAGGAATCCTGATTGCTTCTTCCAGAACGTTGCCAGG
CTTTTAAAGAAAAAATCCACTGCAACGTTTAGGAAACAGA
TATCTATTACTTCCTCTCTGCTCTGGAATAGGCAGCAACA
TAGCACAGAATCATAAATCCATTGCAAATTAAGCACACCG
ATCTAATAAAAGATTAATTTGCAGTCAGATCAAATGGATG
GGCTAAAACATAGCAGATATCAATATTGTCTGTCCTGTAA
AAGGGAAACAGCATTTACCATATCCCTCAGTACAGTTAAC
CACGTCATGTAAACGTTGCCCTTCAAAATAAATATATTGT
GGGCAGAAAAAAATATGGCAAGAAACACATTTGGGCTCTT
TTCTATTTGGATAATGAAGTGTCAACAATTTTTTCATATA
ATTCTTATTTGTATTTTTATTTTATTTCTTTTGGTTTTCA
AATTCAAGCCACTTTTACGTTGCCACAGTTAAATTGTTCT
TTACAACTGAAGACCAAAGTGCATTGAATGCCCTTTGGCC
AGTCTTGTATGTGCCTTGATCCAATGCTTATTGTATTTAG
CTTTTACAACAAAAGAAAAAAAATCAGTGACTTAACTTTT
TTCATACACACTTGAATATGATAGGATATTGGTCATATTG
CAAATAAAAGTGGATAAAACCCCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations