ZFIN ID: ZDB-TSCRIPT-090929-17940
Transcript Name: pax2a-203
Previous Name: pax2a-010

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037531 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037531|OTTDARG00000027765|ZDB-GENE-990415-8 pax2a|OTTDARP00000030080 pax2a-010 LG_none CT025909.13,CU104681.5 Danio rerio protein_coding KNOWN, 1148 bp
TATTAATGGCATCCTAGGAATCCCTCGCTCCAACGGCGAA
AAGAGAAAACGTGATGATGTTCTCTGGAGTGGCAACCACT
TGGATGGGAGGAAAATAGGATATTATGGTTCAGATGGCTC
TGGCCCTAACAGTGATTCTCAGGGTAGTGTGGAGAGTTTA
CGGAAGCACCTGAGGGCTGATGCCTTCACTCAACAGCAGC
TGGAGGCTCTGGATCGGGTGTTTGAGCGGCCGTCATACCC
CGACGTCTTCCCCACGTCAGAACACATCAAGCCAGAGCAG
GCTAATGAGTACTCGCTACCAGCACTGAACCCTGGACTGG
ACGAAGTCAAGCCCAGTCTGTCAACCAGCGTCAGCTCAGA
TTTGGGCTCCAGCGTGTCACAGAGCTACCCAGTAGTGACA
GAGTCACATTCATCCTCCATGTGCGTTAAGCAGGAGCCGC
ATGAGGCTTCCCTGGCTCCTTTCACCCCTTCCTCACTGGC
AGTGTCGGGCCTTGCAGAACTGTTGCCCCTCCAGCCCAGC
GTGTCAGTAGACGCCTCCACCCCCTGCTACGGTGCCTATG
CCCATCATGCGCCCAGCTACTGCCAGTATACAAGCCAGCA
TATTATAGCAGGTCGAGAGATGGCGAGCACGACCCTACCA
GGATATCCACCTCACGTTCCCCCTACTGGGCAGGGCAGCT
ACCCCACCTCTACACTTGCTGGAATGGTCCCTGGAAGCGA
CTTTTCAGGAAATCCCTACTCTCACCCGCAGTACACAACT
TACAATGAAGCTTGGCGGTTCAGCAACCCCGCGTTATTAA
GTTCCCCTTATTATTATAGTGCCGCATCCCGGGGCTCCGG
GCCTCCCACTGCTGCCACTGCCTATGACCGCCACTAGTTA
CCATCGCAGCCCAGTCAAACTGCAGGACCACGGCCGCGGC
CTCCATATCGTACCCGTCTGAATGGTCAGAGGGATTGAAG
ATGGATACGCCATCTTCACTTTCATGGAGCCGAAATCCAA
TTCGGAGGGTCAAGCAACAGCGGACATCCACTACATTCCC
CCCCTTTGGCACCATCACTGAACTATTTCCTGAAAAACTT
TGAAAGATTCTACGAAAATATATATATTATACGAGATATA
AAACAAGACGAACCATGTGAAGAACTAC

pax2a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pax2a-202 (1)    Ensembl 3050
pax2a-203 1148
pax2a-205 (1)    Ensembl 1126
pax2a-206 (1)    Ensembl 1221
pax2a-207 (1)    Ensembl 879
pax2a-208 (1)    Ensembl 1202
pax2a-209 (1)    Ensembl 1190
pax2a-210 (1)    Ensembl 1171
pax2a-211 (1)    Ensembl 1145
ncRNA pax2a-006 (1) 323
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pax2a-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037531 (1),  Ensembl_Trans:ENSDART00000132004 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CA471205 (1) 832 nt
GenBank:AL927941 (1) 534 nt
CITATIONS (2)