ZFIN ID: ZDB-TSCRIPT-090929-17937
Transcript Name: pax2a-211
Previous Name: pax2a-007

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037528 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037528|OTTDARG00000027765|ZDB-GENE-990415-8 pax2a|OTTDARP00000030077 pax2a-007 LG_none CT025909.13,CU104681.5 Danio rerio protein_coding KNOWN, 1145 bp
TATCCCATATAGGGCACGGCGGTGTGAACCAGCTAGGAGG
GGTGTTTGTGAATGGCAGACCCCTACCTGACGTGGTCAGG
CAAAGAATCGTGGAGCTCGCACACCAAGGAGTCAGACCTT
GTGACATTTCAAGACAACTACGGGTCAGCCATGGCTGTGT
CAGCAAAATTCTCGGAAGATATTATGAAACCGGCAGTATT
AAACCTGGAGTTATTGGGGGGTCCAAACCAAAAGTGGCGA
CGCCCAAAGTTGTGGAAAAAATCGCAGAATACAAGCGGCA
AAATCCTACAATGTTCGCCTGGGAGATCAGAGACCGACTC
TTGGCCGAAGGCGTTTGTGACAACGACACAGTACCAAGTG
TTTCATCTATAAACAGGATAATTCGAACCAAAGTTCAGCA
GCCTTTCCACCCATCCTCCGACGGCACAGGAACACCTCTT
TCCACAGCGGGACACACTATAGTGCCCAGCACAGCCTCCC
CACCTGTGTCAAGCGCTTCCAATGACCCCGTGGGGTCCTA
CTCTATTAATGGCATCCTAGGAATCCCTCGCTCCAACGGC
GAAAAGAGAAAACGTGATGATGATGGTTCAGATGGCTCTG
GCCCTAACAGTGATTCTCAGGGTAGTGTGGAGAGTTTACG
GAAGCACCTGAGGGCTGATGCCTTCACTCAACAGCAGCTG
GAGGCTCTGGATCGGGTGTTTGAGCGGCCGTCATACCCCG
ACGTCTTCCCCACGTCAGAACACATCAAGCCAGAGCAGGC
TAATGAGTACTCGCTACCAGCACTGAACCCTGGACTGGAC
GAAGTCAAGCCCAGTCTGTCAACCAGCGTCAGCTCAGATT
TGGGCTCCAGCGTGTCACAGAGCTACCCAGTAGTGACAGG
TCGAGAGATGGCGAGCACGACCCTACCAGGATATCCACCT
CACGTTCCCCCTACTGGGCAGGGCAGCTACCCCACCTCTA
CACTTGCTGGAATGGTCCCTGGAAGCGACTTTTCAGGAAA
TCCCTACTCTCACCCGCAGTACACAACTTACAATGAAGCT
TGGCGGTTCAGCAACCCCGCGTTATTAAGTTCCCCTTATT
ATTATAGTGCCGCATCCCGGGGCTCCGGGCCTCCCACTGC
TGCCACTGCCTATGACCGCCACTAG

pax2a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA pax2a-006 (1) 323
mRNA pax2a-202 (1) 3050
pax2a-203 (1) 1148
pax2a-205 (1) 1126
pax2a-206 (1) 1221
pax2a-207 (1) 879
pax2a-208 (1) 1202
pax2a-209 (1) 1190
pax2a-210 (1) 1171
pax2a-211 1145
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pax2a-211 Contained in:
OTHER pax2a-211 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037528 (1)
  • Ensembl_Trans:ENSDART00000144443 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF067541 (1) 1188bp
    CITATIONS (2)