ZFIN ID: ZDB-TSCRIPT-090929-17722
Transcript Name: gem-201
Previous Name: gem-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037298 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037298|OTTDARG00000027647|ZDB-GENE-060825-251 gem|OTTDARP00000029886 gem-001 LG_ BX511010.5 Danio rerio protein_coding KNOWN, 1538 bp
AAAGCACATTACTGCGCAAAATATAGACGAACAGGATTAC
CAGGGCAGACAGCAGCAGTCCTCAAGAGTTGCATGCGCTT
AATTGAACTCATCGAAGCCAAGAACAATTAAATCTCGCTG
AGCAGGTTTCTGCTGGATGGGACTGGATCTGTTTTGAGCA
CAATTTTACGAAGTCCGATTTAGTCCGCTAATTCTTTGCC
CTAGGCGCACTCAAAGACAGCATTCGTGTAACCTACTGTT
AGTCGCCAAACTGCACTCATGACCCTGCTGGCGAGCGTGC
GACGCCACAGTATCCGCGTACAGCATCACCTGCACCGGTG
GAGCATCTGCGGAACGGACGGAGGGCAGCTGCTCAACGAT
GCTTTCCCGCGCTCCGACATCAGTATGTCCCGGTCCAGTT
CCTGCTCCTCCGCGTCCTCAGATTCCGCTCTCTCCACAGA
GTCTGCGACGCCGGCATCAGTTGGACCCTTTACTGTAGTT
CTGCTCGGGGACAACGGCGTCGGGAAGTCCGCTCTCGCTA
GTATATTCGCCGGAGCATCGGACAGCATGGGCAGCGAGTG
CGAGTTATATGGAGGTGAAATATTTGAGCAGACAATAACA
GTAGATGGCGAGAGGGCCTCCGTCACCCTACTTGACACAT
GGGATTCACAGGATGAAGGCAGCTGGACACAGCAGCGATG
TTTGCAGACAGGAGATGCCTTCATTATAGTTTATGCCATA
ACAGATCGTTCAAGCTTCCTTCGTGCATCAGACCTTCGTG
TTCAGCTGCGGCGTGAGCGTGAGGTCGACCGTACTCCCAT
CATCCTGGTGGGCAATAAATGTGACCTGGTCCGCTGTCGA
GAAGTGTCCATTAGTGAGGGTCGTTCGTCAGCGGCTGTCT
TTGACTGTAAGTTCATCGAGACGTCCGCAGCAATGCAACA
CAACGTCTGGCCGCTGTTTGAGGGCATCATCCGCCAGCTC
CGTCTGCGAAGAGACAGCATGGAGACCCTCAGCAGCCATT
CATCTCTCCAAAAACGCAGGGAAAGTCTCCCAAAGAAAGC
CAAGAGATTCATTAACAGAATGGTTGCTAAGAAGAACAAG
CAGGCGGCTTTTAAACTCAAGTCTAAATCATGTCATGACC
TGATGAGTCTGTAACAGTGTGACTTTGAATGCTTTTTGGC
AAGTGTCTGATTTGTTTTGCACCTATTTTGCTGTATGAGA
TTTTTGATTTTTTTTTTTTTTTTATAAAGCCGTGGATGTC
TATATTAGACTGTGCTGTGTATCGCAGGCTTCTCGCTCCC
TCTGTGAAGGACAGAACGCTTTAGTGTTATGCATTGCCCT
CTAAATCTCTCACAAACCATGAAGTACATCAGTGTTTTTG
TGGGAACCCCAACCACTTTTTTTGTTTCTTTTTTATATGA
TCCTCCTGATGGAATTACTTTTGAATTGTGTGTACATTTA
TGTGGATGTGTGTGTAAAAACAACATGTTTTGTCCAACTT
TTGCTCAGTTTGAGCCTATGATATCCATAACCAATAAAAT
ATTGTTTTATATGATGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gem-201 Contained in:
[BAC] CH211-79L20 (1)

Genome Resources: Vega_Trans:OTTDART00000037298 (1),  Ensembl_Trans:ENSDART00000048036 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC122113 (1) 1557 nt
CITATIONS (2)