Transcript

ist1-003

ID
ZDB-TSCRIPT-090929-17643
Name
ist1-003
Previous Names
  • zgc:55671-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037217 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037217|OTTDARG00000027602|ZDB-GENE-030131-179 ist1|no_translation DKEY-84O12.1-003 LG_none CR848662.7,CR382281.9 Danio rerio protein_coding KNOWN, 705 bp
GAAGTCACATCCAACACGGAAGTGAATGCTAAGTGAGAAG
TCGCCCAACCAACCTGATCGAAACCGACCGTTCGCCAACG
TCTGAGGAGGAATTCACATAGCTCCATCATGCTCGGTGGA
GGGTTCAAATCCGAGAGACTTCGTGTCAATCTCAGGCTGG
TCATAAACCGCCTTAAACTTCTGGAGAAGAAGAAAACCGA
GTTGGCCCAGAAGGCTCGCAAGGAAATTGCAGACTACTTG
TCAGCAGGCAAAGATGAGCGTGCGAGGATCCGAGTCGAGC
ACATCATCAGAGAGGATTATTTGGTCGAGGCCATGGAAAT
CCTTGAGTTATACTGTGATCTGCTGCTCACCCGCTTTGGC
CTAATTCAGTCAATGAAAGAACTGGATCCGGGTCTACAGG
AGGCAGTGTCCACACTCATCTGGGCAGCTCCTCGCCTACA
ATCAGAAGTAGCAGAGCTGAAGATTGTTTCAGACCAGCTC
TGTGCCAAATACAGCAAAGAGTATGGAAAGCTGTGTAGGA
CAAACCAGATTGGAACAGTTAATGATAGGGTATGATGAAA
CGATTGTTTTGAGGTGGGGGAAATGACCCAATAGTGTTTT
ATGTTTGTGAAAACGTTATAATAATTGTTTTGAAATTTTA
TTATTCTGTCATCAATGCCTCTGAGTAATCTGCAAATGTT
TTTTCAATTTCCAATTGCAGAGTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations