Transcript

ist1-202

ID
ZDB-TSCRIPT-090929-17642
Name
ist1-202
Previous Names
  • ist1-002
  • zgc:55671-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037216 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037216|OTTDARG00000027602|ZDB-GENE-030131-179 ist1|OTTDARP00000029826 DKEY-84O12.1-002 LG_none CR848662.7,CR382281.9 Danio rerio protein_coding KNOWN, 2267 bp
GGAAGTGAATGCTAAGTGAGAAGTCGCCCAACCAACCTGA
TCGAAACCGACCGTTCGCCAACGTCTGAGGAGGAATTCAC
ATAGCTCCATCATGCTCGGTGGAGGGTTCAAATCCGAGAG
ACTTCGTGTCAATCTCAGGCTGGTCATAAACCGCCTTAAA
CTTCTGGAGAAGAAGAAAACCGAGTTGGCCCAGAAGGCTC
GCAAGGAAATTGCAGACTACTTGTCAGCAGGCAAAGATGA
GCGTGCGAGGATCCGAGTCGAGCACATCATCAGAGAGGAT
TATTTGGTCGAGGCCATGGAAATCCTTGAGTTATACTGTG
ATCTGCTGCTCACCCGCTTTGGCCTAATTCAGTCAATGAA
AGAACTGGATCCGGGTCTACAGGAGGCAGTGTCCACACTC
ATCTGGGCAGCTCCTCGCCTACAATCAGAAGTAGCAGAGC
TGAAGATTGTTTCAGACCAGCTCTGTGCCAAATACAGCAA
AGAGTATGGAAAGCTGTGTAGGACAAACCAGATTGGAACA
GTTAATGATAGGCTTATGCACAAGCTGAGCGTGGAGGCTC
CTCCCAAGATTTTGGTGGAACGTTACCTCATTGAGATCGC
CAAAAACTACAATGTTCCCTATGAACCAGATGCCATGGTT
CGGCCGGAGGTGTGTCCTGGTGAAGAGGCTGATCTGATTG
ATGTGGACAGTGACTTCAAGAAGCCTGGAGCTGGTGGAGG
TGGTGGTGGAGGAGGAGGATTCACTGCCCCTGCCATGGGC
ATGCCTATGCCCATGCCAATGCCAATGCCCATGCCCACAG
CTTTCAACTACCCACCGCCCAAAGGAGCTGAGCCCTTTAA
TGGTCCTGTTGGCACCTATGATGGCTTTAGCAACTTCCAG
GCTCCGATGAGAGGAGGACAGCCTCCTCAGCTGCCCAGCT
GCCCGCCAACTTATGAGTCTGTCATCCCAGGTCCGACTCC
AGCTGGTCAGGTCTATGACAACTCCACCCTTCCCGAACTT
CCGTCTGTTCCAGACACACTCCCAGCATCCTCTTTCGGAG
CGAAGGCCAACACCTCAGAAGACATCGACTTTGATGACCT
GTCGCGACGCTTTGAGGAGCTCAAGAAGAAGACCTAAACA
GATCCAGATCACATCAGAACACATTGCTCGAACAGTTCAA
TCCATATTCACAGCTCTTCTCTTCAGGTGAAGGTGTATTA
TAATATTAGTTATTTAACAGAAGGAATGATGGAGACACTT
TTGAATGGCAGTATCAGATATTTCTACAAACTCACTTCAG
ACCTTTAGGTAAACATGATGGACTACTGACAGAAATCTTT
TAAATTGAGGAGCACTTTGCATAGAGGGACTTGCTGACAG
CTAAAAGTAGTTCAATTATAGTGACTGCGCATATATCCAT
TATATAAGCTGACTATTATTATGAAATGTCTCTTAACTTT
CCCCAGTTTTAAGAAAAAGTCTAAAAGATTTCCCCAAGCA
AATCAGAAATCTGTATGACTCCTGTAGGCAAAGCAGGTAG
AACCTGTTGGCCCTTATTTACACCCAGATCTATGTAATGA
ACTCTTTTGAATGACTGAACCTGCGTAAGACCGTATGATG
TCATGGATTATGTGTTCGTGGATCGCAGTTGTTTTTCAGA
GTGACTCAGCTTTTCTTCTGCTATTGACCGAACACCATTC
AGACGTTACATTTGAGGGAATGTGAAGAATAGTGCTGCAT
TTCTCACCTGAACACCAAAGGTTGCTTGTTTCTGATGTGA
GCTGAGCACAGAATGTCCTAACATTCGTTTTTTGTTCTGT
TAATGTGGTGAAGTCTGTGAGCGTTTTGAGAAACTCCAAA
TGTCAGCCTTTCTTCATTTGATTCTCACTCGTAGTGTTTG
GTCTCCAGTTTCTAGTGTTTTCTGCACTGAGTTTGCCTTA
GTTTCCTTCTCTTCCACCGTGGCCTTGCTCTTTCACTGCT
CCCTCTGTCAGCTTGTACACTAGTTAATTCTTCTCTATGG
TGAGGGTTTTATCATTTAGTATCGACTTTGTTTGTTTGTT
AGAATTGACTATGTATGAGTCTTACGTTTGTTTTGAAGAG
TAAGGAGGCTTGTATAGTAGGTTTTATATAAATGGTTTGC
TTTAACTTTATAACACTATTTTGTGTTTTGTTTTCGCCCT
TAAATCATCTGAACACAAATCTGGCAATGTTTGGGTGTGT
TTGATACTTATTTTATCTGAATTAAAAACATATCTGATTC
CATGTAATAAATTCTATTTGCTCATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations