Transcript

her12-201

ID
ZDB-TSCRIPT-090929-17379
Name
her12-201
Previous Names
  • her12-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036935 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036935|OTTDARG00000027459|ZDB-GENE-040824-5 her12|OTTDARP00000029610 her12-001 LG_ CU062502.10 Danio rerio protein_coding KNOWN, 1050 bp
CTCACAATTCTTTTTGGCACAACATAAAGCAAGCTGTTCG
AGCACAGACATGGCACCCCACTCAGCCACACTCGCCTCCT
TTGACCATCTTCACTTCAGCGATAAGGAAAAAATAAAGCT
GAGGAAGCCGATAGTTGAAAAGATGCGTCGGGATCGAATC
AACACCTGCATTGATCAGCTGAAAAGTCTCCTTGAGAAGG
AATTCCACAGTCACGATCCCAGCACCAAACTGGAAAAGGC
TGACATCCTGGAAATGACTGTCAGCTTCCTGAAACAGCAG
ATCAAGCAACAGCAGCAGATCCCTCAGAGAGACTTTAATG
AAGGCTATTCTCACTGCTGGAGAGAGTCTGTCCACTTCCT
CTCGCTTCACTCCAATGCTGGAGAGCTCCAGCATCTCCAC
AGTGGCCCGAAAACCAACTCAACCATGGGCTCTACTCCAG
CAACAGCCTGCTCTAAACTGAACACAGCTGCTTTACAGCA
CCCAGACAGCGTGAGGGCCGTCTGGAGACCCTGGTAGAGA
TCCTGTGGACTGACAACCCTGAGGGACGGTGGTATTAACA
TCTCTCATAAAAGTAGGAGATATGGATTTCCAAAGCGTAT
GTTTATAGTTGTCATCATATTGATCGACAAAAAACTGTTG
ACGAACACGTGTTCGTCTGGGAAGGAGGTGGATTGCCTCA
TCCTTAGCTCTTAATGCTTATGTATTAATTCAATTGTGGT
TTGTATGCATTTTTAATTGACTCCAGTGGAGTTTGATGTA
TCAGAACTTTGAACTGATTTTGTACTTAATAGTTCCATTT
CTGTTTGCACTGAGGATTGTTTGTTAGGTGAGGCATTTTG
TACCTTTGATAAAGGATCCAGTTTGTTATCTTGACCAATG
ATGTGTTATTGTTTGTTTGTTGTTAGTTTTTTTTTTTTTT
TTTTTGGGGGGGGCTCTTATGACAAATTTTTAATCAATGT
TTGCATGTTTCAGACCCCTGTTTTTTTACTTGCTTAATAA
ACTGCCGCAAAATGTGCAAGAAGTACAATAAAAAGCATTT
TCTATGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations