Transcript

rbpjb-201

ID
ZDB-TSCRIPT-090929-17310
Name
rbpjb-201
Previous Names
  • rbpjb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036864 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036864|OTTDARG00000027415|ZDB-GENE-070319-1 rbpjb|OTTDARP00000029551 rbpjb-001 LG_none BX664612.15,CR936844.8,CR352260.13 Danio rerio protein_coding KNOWN, 3196 bp
TTTCTCTCTCTCCCTCACTCCTTCAGCCTCCAGTCTGCTT
CTGTTGTCTCGGTGGCTGGAAGGGTCTGGGAGAGGAGGAT
CTCGCGAGTCTTGGAGTTTTGGTGAGAGTTTGTGGAAGAT
GGCGCCTGTTGTGACAGGGAAGTTTGGGGAGCGCCCTCAA
CCACAGCGCCTGACGAGAGAAGCCATGCGAAATTACCTGA
AGGAACGAGGAGACCAAACTGTGCTCATCCTACACGCTAA
AGTTGCACAGAAATCATACGGCAATGAAAAAAGGTTTTTC
TGTCCTCCCCCGTGTGTATATCTGATGGGCTGTGGATGGA
AGAAGAAGCGGGAGCAGATGGAGCGAGACGGCTGTTCAGA
GCAGGAGTCTCAGCCCTGCGCATTCATCGGCATCGGGAAC
AGCGAGCAGGAGATGCAGCAGCTCAACCTAGAGGGGAAGA
ACTATTGCACAGCCAAAACATTGTACATCTCAGACTCAGA
CAAACGCAAGCACTTCATGCTGTCAGTGAAGATGTTTTAC
GGGAACAGCGCAGACATCGGCGTCTTCCTCAGCAAGAGGA
TCAAGGTCATCTCCAAACCTTCCAAAAAAAAACAGTCCCT
CAAAAATGCAGACCTCTGTATAGCATCAGGAACGAAAGTG
GCGTTGTTTAACCGGCTTCGCTCACAGACGGTCAGCACAC
GTTACCTGCATGTCGAGGGAGGAAACTTTCACGCCAGCTC
GCAGCAGTGGGGAGCCTTTTTCATCCACCTCTTGGATGAT
GAAGAGTCGGAGGGAGAGGAGTTCACTGTTCGAGACGGAT
ACATTCACTATGGACAAACTGTCAAACTGGTGTGCTCCGT
GACTGGCATGGCTCTTCCTAGACTGATCATCCGTAAGGTG
GATAAGCAGACGGCCTTGCTGGATGCAGATGACCCCGTCT
CGCAGCTGCATAAGTGTGCCTTTTACCTGAAGGATACGGA
AAGGATGTACCTGTGCCTTTCTCAAGAGAGGATCATCCAA
TTTCAAGCTACTCCATGCCCAAAGGAACCAAATAAAGAGA
TGATAAATGATGGTGCCTCCTGGACAATCATCAGCACTGA
TAAAGCAGAATACACCTTCTATGAGGGCATGGGCCCCGTA
CACACACCTGTCACACCTGTGCCTGTGGTCGAGAGCTTAC
AGTTGAATGGTGGTGGAGATGTAGCCATGCTGGAGCTCAC
AGGACAGAACTTCTCTCCAACTCTGCGGGTGTGGTTTGGT
GATGTAGAGGCAGAGACCATGTACAGGTGTGGAGAGAGCA
TGCTGTGCGTCGTCCCAGACATCTCCGCGTTTCGGGAGGG
CTGGCGGTGGGTTCGACAGCCAGTGCAGGTGCCTGTGACG
CTGGTCCGAAATGATGGTATCATCTATTCCACGACACTCA
CGTTCACATACACCCCTGAACCTGGCCCACGACCACACTG
CAGCGCCGCTGGCGCCATCCTACGAACGGGCAGTGCCAGT
TTACTCTCAATAAGCGGGAACAGCACAGGAGGGAATGGAG
AAACAGCTCCATATGGCACCAATAATGCCGTCACGGCATC
ATCCTCTAATGCAGCCGCCGCTGTGGTGTTATAACACACA
AACTCACCGTATGTGAAACTAAGACTAGAAACGTTGTAAA
AGTGCTGCATATTGAATTTCAAAGATAAATCCCTTAAAAG
TGGAGACGGAAATCAAGGAATTGATCAGTGAAAAGGCTAA
ACCTGTGGAGAGGACTAAATATTTGAAATGGATCTTCAGC
GCCCTCTTGTGGTTTGGTGCTAGTAATAGCCGGTTTGGTG
CTAGCATTAGACAATGCCTGAGAGAAACACCAGCACCTTT
AAACAGGTGTTGAAGACCGGAAGACAAGATTCATCAGCCG
TGCGCAAAATGCATTGACTGAAAATGGTTTTCTTTCAGTC
TGTGTATAAAAGCCTGAGAGGTCAAAACTCTTCGGAAAAG
GGTCCCGTTGAAATTGTGAGATAACCCTTTTTAATGGACC
AAGGATATTGTATAAGCTTTAGTAAAGGTACATTTTTCCC
CCCTCCATACCTTTTTATATCAAATGTTATAATTGTACGC
TTTTGTTACCAAATAGGTTGTGCCCCACCTCTGAGCTTGG
TTTTGTTGGTTTTCTGTATATAGATACTTTCATATACACC
CGTTCGCTTGGACACCTTCGGTTTTGATACTTTGTATTTT
GTAATACCTTTTCGTTTTTCATTCATTTGGAAGAAACTCA
GAGGGCCTGTTTTTTATCATTGGTTTTTATGAACTCTTTT
AAAAGAAAAAAAAAAGCTTTAAGCAATGCCTCTGCCTTGC
CTGCATTACGATATGCGCTACGCTTCCTTTAAGCATTTCA
TCACTGACATGTCTAGATCTCACGAAAGGAACGACGCCAT
CTTTCTGTGTCTTATTCGGGAAACTAGAAAACACACAATA
TACTGCATATAGAAGCTTTGGATGCAACGTGTCTCTTCAA
TACGGTAGCCGTAGAGTAGTTTTGTTCTAGAGCACATGTA
GGATATCCCACATATCAATATCAGAGAGTTTACTGTAGTT
TGTGACGTTCAAGTTCTGACCGACTCCTAAAGTTTCAGTG
CCGTTTTATAACGTTGAACATCCAGTGTTTTGTCTTCCTA
AACATTTTTTTAAATTCGGTCCTAAGGGGACGATTTGGAG
ACGTGTCTACCATTAGATGTGGCCTTACTGGAACAAAGGT
TCCCTGTTTAGTTCACCACCTTCAAAAGGAGGTTTACAAA
CATGACCCGAGGAACCAAGCCTTGCATTTTGAACATTTTA
CATGCGATTTTTGTGATATTTAAACTTTCTAAATTTTCAT
TTTGTTGTTCGGATTTAGAAGATTTAAATGTGTTATAGAT
ACAAACATGCCCAAAGATATTATATTGCATTATTGTCTCT
TTTTATTTTTGAAAAGTATGTCTGGATTTGTGGCCTACCG
CACACCAAAAGTAGGAAGCTTTACTCCGTTGGTCATTGAT
GTGTTTATCGTGGCCTTGGTGTCTCAACTAGTAGACTAGT
ATTAATGACAAAAAAAAAAACTAGCTCTAATCAACTCATC
AACCAGCACTAATAGTGTTTTGTGATTTTCTTTTTTATGT
ACAGTAATTTAACTTTTGAATATTATGCGTCCATTTGTAG
AAAAAAAAAACTAAAGATAAAAAAACAACAACAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations