Transcript

her8a-202

ID
ZDB-TSCRIPT-090929-17230
Name
her8a-202
Previous Names
  • her8a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036784 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036784|OTTDARG00000027374|ZDB-GENE-030131-2376 her8a|OTTDARP00000029495 her8a-001 LG_ CR848737.8 Danio rerio protein_coding KNOWN, 3132 bp
GTACTTTCTGCTTCCACCGAGACCACGCCACCACAACCCA
AACGTGCACACTCGTGGGAAACTTTCTGAACTAGTTTCAT
ACTGGTGGAGAATAATGACGGCCTCCAACATGGGCAATGG
TCCGGAGAAGAATTTCAACGCAAAAGAGGAGCGAAAGCTG
CGGAAACCATTGATAGAGAAGAAACGCAGAGAGAGGATAA
ACTCGAGCCTTGAGCAGCTGAAGGGTATAATGGTGGATGC
CTACAATTTGGACCAATCTAAACTGGAGAAAGCTGATGTT
CTGGAGATCACAGTTCAGCACATGGAGAATCTTCAAAGAG
GTCATGGACAGGGTGGAAGTAACAGTCCCGGCACTGGTTT
TGAGTCTCGCCAGAGATACAGCAGCGGCTACATCCAGTGC
ATGCATGAGGTGCACAACCTCCTCCTGAGCTGCCCTGGGA
TGGACAAGACTTTAGGTGCCCGTCTTCTAAACCACCTGCT
CAAATCTCTACCTCACATCAGCACCGAACCCAGCGGTACG
AGCTCCGCCGGGACGTCCAGCCCTCTCCCTCTGTCCCCGA
CCCAGTCCCCAATAAACCTGCCCAGCTCCTTACAGCCCCA
TGCTCTCCTCCTGTCTCCATCTCCACCCTCCAGCCCTACT
CACTCCCTGGTCAGGCCCCGTGAACAGTCTTCTCCACCCA
GCTCTCCTTCTCCTCAGTCTCCGGCTTCCCTTCCCCCTTT
CTTTCCCGGGGTCGATCCTTCCATGTGGAGGCCCTGGTGA
ATGAATACAGCCCTGCCCTCCCCCCTGTTTGGCCTCCTCT
TGCCCTTCCTGGCCTGATAGTTTCCATTGCATTTGATCTC
CTGGGAGGCTGGAGTGCTTTCCATTCAGTGGGGTGCATCG
TATCGGGTTACAGTGGGTCCCACCGGGTCGTGCGCTATCA
TTTAAAGCACTGCTTGGAAGCAAATGATGCTGTTTTGCAT
GAGGGCACGAACACAGATGACACCAAAGCTGCCCTACATC
ACTATGTAGTAGATGATCACTTGTTTAGATGCCTTACTTT
TTGCTTTTTTTAACAATAGTTTTACTAGGTTTGTTTTTTT
TTTTGGATTATGCATGTTTCTTCACACTGAATGCAAAACA
CTAATAGCGACTCAGAATTTGACACGATTGTTTGTGAAAA
ATACTCCATACTTGTATATTACAAGAAGAGTCTGACTAGT
ACCTCATATTGAAGCTGGTTTTCTTTATTAAAAAATAATA
AATTCAAGCTGGGTGTTGATTTTGTACTCTCAAAATGTTT
GAAAATGATGATGATGATGAATAAATAATAATAATAAAAT
AACTAATGAGCTTCTTGCTTCTTTTTTATTTTACAAAGCT
GTAATTTACTTCTAAATTAACTTCTAAATCACAAGTTAAT
GCATCAAACCATACAAATAAATAAATTTATATGTACAGTG
ATCAGCATAATTGAGTACAGCCCATTTTGAAAATTAATAT
TTGTATCAATTTCTCAGTGAATATAGGCAATGTATTTTGG
TGCATTTAAACAAAACCGATTTATTAAACAGATTTATTAA
AATTATATTTTATTCACCAAACATATTTAGAAATTGAAAG
ATAATACAATTAAATTTAAGCAAAATATTGCAAAAACTAA
TTACAGCCTTCAACTAATTTTTTTTTGTTTCTCTTGATTT
TTCCTCTTTTTAAATATGAGTGTACTAGCTTTTGGACCAA
TGTCATCAGTTATTTTGTTACTTAAGCTCCAGATTTGGCT
TCAGTACTGACTAATCTAATGTATATGCACAAATATAATA
TTGTAAAGCTTGCTATTAAACATATGAATGTAAAAGAGAG
ATTTGTGAGGGGTGTATGCTGAGCCCTGTACATATTAGAT
GCTATTATTCACTATGTATATTACACATTATTAATTTGCT
ATTATATTTCACATTTTTAACTTGCTAAGAACTTGTGTTT
ATTACATAATATTAACAGATGTCTTAGTAAATTTTTAACT
TAACATTAACCGGTTAAACATAGGTTGCCTACATCAGAAA
GATTTTTCTTTCATTGTCAAGTTAACAAAAGAACCGTTTT
CGGAAATCATTACCAATGCGTCACTCAGATTTGAATTATT
TTGTACACCTTATGCCTCATAAACAAGTTGATCTAGCATA
TTTTATACAATAATAAACCAACATTCCATCTTGAATTAAA
TAATGTTCGCACTTTTTTAGTTGCTAATTTATTAGTGGAT
ATTTTAACAGGCTAAAGAGCTGAAGATCAGTAACACATAA
ATCAGAAGATCTGTTAAACTAATTACCCGAATTATAGCAA
ATAATGTGCTACCAAAATGCGAGGAAATTATGTTATTACT
TAAAACAGCCACTAGATGTCATCAATCACACGCCAAGTCA
CACTGTAGCCACATGCTAAACTAATCAAAATAACTGCCCC
CTAATGGATATAACATAGCTTCTGTTTTCTACAAAAGAAA
GATGTCTGTAAAAATAAATAGACCCTATTTATTTAGTAAT
GTGGTCAAGTTTACTTTCCAGTTGTTTAAAACGCAACATT
CCACGTTTAATCCTGATTGTTTTTTTTCCTTTTCATTGAA
GGTATTTGTGAACTTTAATAGCAATTTTAACTGAAAAAAC
AAAGTGATTAGCGATTAGCCTACAAAGTGATTTTTTTCAG
TCCTGCTTGAGGCAAGCAAATAGGACGAGCCCTTTTCTTT
TTAAAATAGCAAGGCTTCACTTTGTACACGTGCATGCATT
AAACACAGGTTTACAAACCGTTATAAATCCTCAAGAATAT
GAATGAGGGCCAAAAATTCATATTTTATGACCAGTAGAGA
TTTCTTTACCAATAGTTTTAGACATCACTGACTAATTCCT
TCCCAAAGCTTTGTTATGTTCACAGTTCCAAATACAATGA
GACAATGTTCCTTATGCCACATGGTATCCATAATATTTTG
ATTATAATCCAGTTATACTTGAAGTGTTAATTAAAAATGT
ATGTGCTCAAACACATTTTTTCATCTCAAGATCATAAATT
CAAGCAATTTCTTTTTGTGATTTGAGTTTTGTATGTGTTG
ACAAATTTGCAATTAAACTGAAAAATAAAACTTTTGCTGC
TTATTTAAAGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations