Transcript

cby1-202

ID
ZDB-TSCRIPT-090929-17218
Name
cby1-202
Previous Names
  • cby1-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036772 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036772|OTTDARG00000027366|ZDB-GENE-030131-5074 cby1|OTTDARP00000029487 CH211-141O9.5-003 LG_ BX000473.6 Danio rerio protein_coding KNOWN, 527 bp
TCCGGCGTTGCTAGGCTCCCCCCGGAATTAGCCGTTTGTT
TACACATGTCTCTTATGGTTTCAGGAGCATCTAAGAAGCT
GTCGTGAGGAAAATGCGTTTGTTTTATAAAAGCAGTTTCA
CTCCATCAATAAATTGAATACTATGTGTTAATAACGTGCA
TGTAAGTTACTAGTAAGTTAGCGCGAATCTCGAAGCTAAC
GGTAGTCTCACCTCCACGTTTGGTTAAGAAGTCAGACTAT
CTACTTCAAAATGCCCCTCTTTGGCAATATTTTCAGTCCC
AAGAAAACCCCACCTCGAAAGTCTGCATCGCTTTCCAATC
TACATACATTGGATCGGTCGACCCGTGAGATTGAATTGGG
TCTGGAATATGGATCTCCTGTGATGAACATTGGTGGTCAG
AGCCTCAAATTCGAAGACGGACAGTGGATTTCAGAATCGA
CAGCAGAAACACATCTAGTACAGAAGGAGCTTGAAGATAT
GAAGAGCAGTTCTAGGAGAAAGAAATAAAGGGAGGACACC
TTTTATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations