Transcript

cby1-201

ID
ZDB-TSCRIPT-090929-17217
Name
cby1-201
Previous Names
  • cby1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036771 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036771|OTTDARG00000027366|ZDB-GENE-030131-5074 cby1|OTTDARP00000029486 CH211-141O9.5-002 LG_ BX000473.6 Danio rerio protein_coding KNOWN, 778 bp
GCCGTTTGTTTACACATGTCTCTTATGGTTTCAGGAGCAT
CTAAGAAGCTGTCGTGAGGAAAATGCGTTTGTTTTATAAA
AGCAGTTTCACTCCATCAATAAATTGAATACTATGTGTTA
ATAACGTGCATGTAAGTTACTAGTAAGTTAGCGCGAATCT
CGAAGCTAACGGTAGTCTCACCTCCACGTTTGGTGAGTCA
CTTTGAGATCAAGATGAACTGTCTTTTGTTCAACTTTAGT
TGACTGTAATCAAAGCCGAACTCGAACACTATCACGTTGT
AAAATGTTGTCGATTTACGCTTGTGTTATTGATGCAGGTT
AAGAAGTCAGACTATCTACTTCAAAATGCCCCTCTTTGGC
AATATTTTCAGTCCCAAGAAAACCCCACCTCGAAAGTCTG
CATCGCTTTCCAATCTACATACATTGGATCGGTCGACCCG
TGAGATTGAATTGGGTCTGGAATATGGATCTCCTGTGATG
AACATTGGTGGTCAGAGCCTCAAATTCGAAGACGGACAGT
GGATTTCAGAATCAGGTGGAAATGTGTCAGGAAAAGAAGT
TCAGCGACTGAAGAAGAGGAATCTACAGTTAGAGGAGGAG
AATAATCTGCTCAGGCTGAAGATTGAAGTTCTTCTTGATA
TGCTTTCAGAATCGACAGCAGAAACACATCTAGTACAGAA
GGAGCTTGAAGATATGAAGAGCAGTTCTAGGAGAAAGAAA
TAAAGGGAGGACACCTTTTATATTACTTTGTATATTTAGC
TTTTTTACATTTCATTTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations