ZFIN ID: ZDB-TSCRIPT-090929-17118
Transcript Name: ncoa5-003
Previous Name: zgc:92194-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036657 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036657|OTTDARG00000027305|ZDB-GENE-040912-155 ncoa5|no_translation CH211-59D13.1-003 LG_ CR847793.15 Danio rerio protein_coding KNOWN, 733 bp
GTGATCTCTTTCTGTTGTTGCAGAGCACAGGAACATGCCT
ATTCAGGATGCCATGGTTTTGGTGGCGCACAACTTTGAAA
CCTTTAAAGTTGAGCACCGCGCTAAAGAAAGAGACGAAAT
TGCAAGGAAGGCAGCTAAGATGGCTGATGACGTATTGATG
AGGGAACATGAAAGAGAGGGTCATCCGGTTTCTGTTTTGA
CTGCGATTACGCTGCTGTCTGAGGGCAGGTTTATGACTCC
AGAAGAGCTAGCCAGGCTGATCGAATATCTCAGAGATAAA
CGTGATCGTCTTGTCAGGAGCACTACTGACGCAGGACCCC
ACCCTTCATCTGCGACCCTCGAGCCCTCTCAGCCTACACA
GGCCATTTCGGCTCCAGCTCAGCCCACATACTCCAGCCTG
AGCCTCCAGACCAGCCATCTGACCCCTGCGTCCGCTCCTG
CCCAAACCAACCAGCAGGAGCTCCAGGCTAAAATCCTCAG
CATCTTCAACAGCGGCAGTGGCTCATCTGTGGCCTCCAGT
CCGGCTCCAGCAGCCCAAACGCAGGGTTACCCACCCAGCC
TCCTAACCCAGACCACTAGCCTTCAGGCAGCAGTCTCCGC
CTTGCCCAAAGTCGCCACCGTCCAGCCACAGAGCAGCATT
AGCCCTCGGCCTACGCTCAGGCCTCCAGTTGCACGTATGG
CTGCTCCCGCAGGAGCAGCTAGACCAACAGTCACCGCCGG
CACCGGGATCAAT

ncoa5 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript ncoa5-202 (1)    Ensembl 715
mRNA ncoa5-201 (1)    Ensembl 1911
ncRNA ncoa5-003 733
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ncoa5-003 Contained in:
[BAC] CH211-59D13 (1)

Genome Resources: Vega_Trans:OTTDART00000036657 (1),  Ensembl_Trans:ENSDART00000141700 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT644573 (1) 752 bp
CITATIONS (2)