header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17117
Transcript Name: ncoa5-202
Previous Names: ncoa5-002, zgc:92194-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036656 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036656|OTTDARG00000027305|ZDB-GENE-040912-155 ncoa5|OTTDARP00000029405 CH211-59D13.1-002 LG_ CR847793.15 Danio rerio protein_coding KNOWN, 715 bp
GCCATCCAGCTCTTATGGGGAGAGTCGCGAGCCCCGTCCT
CGCTCTCGGTCCCCGGTGCACGCACGAGATTCTCGCTACC
ACCGTGAAAGTCGAGAGATGAGGGCCAGCAGCCGTGAATC
GCGTCCCTCTTCTACACGTGAACATGAGGATAGACCCCCA
GCTGAAGAACGATACAGGGGGTCTGAGAGCAGGGAGAAAG
AGCCTTCTTTAAGTGTTTTTACAGAGAGGAAGGTTATGAT
CGTTATTATCGTGGAGATTACGATTATTATCGGAAGAAAG
ACGAGGCATACTCGGATCGATACAGAGACCCCTGGAACGG
CAGAAGAGAGCCAGAGGAAGAGCGCATACGTCCTGAAGAG
CGGCGCAGAAACGAACTCTACCGCCAATATTATGAAGAGC
TGCAGAAGCGATATGACATTGAGAGACCAGTGGACTGCTC
TGTCATAGTGGTCAACAAGCTGCAAAAGGAATATGCTGAA
ACGGTGGGCAGGAAGGTTCGGGATCTGGGTATGGTGGTGG
ATCTAATCTTTCTGAATACTGAAGTGTCTTTAACTCAAGC
TCTGGAGGATGTGAGCCGGGCTCGTACGCCATTTGCCATC
ATCATTACCCAGCAGCACCAAGTTCATCGTTCCTGTACCG
TCAATATCCTCTTTGGGACACCACAAGAGCACAGGAACAT
GCCTATTCAGGATGCCATGGTTTTGGTGGCGCACA

ncoa5 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript ncoa5-202 715
mRNA ncoa5-201 (1)    Ensembl 1911
ncRNA ncoa5-003 (1)    Ensembl 733
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ncoa5-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000036656 (1),  Ensembl_Trans:ENSDART00000135296 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK025768 (1) 815 bp
GenBank:CF997847 (1) 791 bp
CITATIONS (2)