Community Action Needed: Please respond to the NIH RFI
Transcript

ilf3a-204

ID
ZDB-TSCRIPT-090929-17052
Name
ilf3a-204
Previous Names
  • ilf3a-006
  • zgc:113842-006
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036589 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036589|OTTDARG00000027266|ZDB-GENE-030131-3151 ilf3a|OTTDARP00000029351 CH211-276A17.3-006 LG_none CR394534.6,CR954228.5 Danio rerio protein_coding KNOWN, 624 bp
TTTGCATTACGACTGTCAGCGTTTGGGCAGCTTTACAAAG
TTTTGGGAATGGACAGGCTCACTTCCAAAGCTGCTAGAAT
GATTGAACACAGAGTGCCTGATCCTCCAATAAAGAGACCA
AGGGAATCTTTTGATGGTGGGGATTTTGATACTAGGCTGA
AGTTTCCAAGAAAAGAAAGGAAAGAGCCACCAAATGCCCT
GATGAAGCTAAATCAACTGCGTCCTGGGACTGTTTACAAA
TTGGCATCACAGACTGGGCCTGAACATGAGCCTCAGTTCT
CAATGACTGTAGAGGTGGATGGGGTAACATATGAGGCAAC
AGGCCCTTCCAAACGCAGCGCCAAGCTCCATGTTGCCCAG
AAAGTACTGGTGGCGTTAGGTGTACCTCTGCCATCAGAGA
CCAAGCCGGCTGAGGAAAAGAAGAGCCAGTCTGTTTCCAC
TCCTGCAGCCACTGCTTCAAGTGAAAACACTCCCACAGGC
TCTGATGACGGCGCTGAGGGTGGCCCCATCCTCACCAAAC
ATGGCAAGAATCCCGTCATGGAGCTCAATGAGAAGCGCAG
AAGTCTGAAATATGAGCTTGTCTCTGTCAAGGGACGCTTC
AACGACAAGACCTTCACTATTGAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations