Transcript

ilf3a-005

ID
ZDB-TSCRIPT-090929-17051
Name
ilf3a-005
Previous Names
  • zgc:113842-005
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036588 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036588|OTTDARG00000027266|ZDB-GENE-030131-3151 ilf3a|no_translation CH211-276A17.3-005 LG_none CR394534.6,CR954228.5 Danio rerio protein_coding KNOWN, 945 bp
GCTAAAGTGTCCGGGCTTGAGTCGTGTGTCATTGTGATTC
GGATCTTGCGGGACTTGTGTTCCCGTGTTTCAACATGGGC
ACCGCTCAAAGGCTGGACTCTTGAGTTGCTGTGTCAGAAG
GCCATTTCCACCAGCGAGAGGATGCTGGGTCCTGGAGAGG
CTTTTCGCAGAGTTCTGGAGTGTCTTGCTTCAGGGATTAT
AATGGAGGGTGGTCCAGGCATTTCTGATCCTTGTGAGCGC
GACACCACTGATGCTGCCGTGTATCTTACATCGCAGCAGA
GAGAAGACATTACCCAGAGTGCACAGTTTGCATTACGACT
GTCAGCGTTTGGGCAGCTTTACAAAGTTTTGGGAATGGAC
AGGCTCACTTCCAAAGCTGCTAGAATGATTGAACACAGAG
TGCCTGATCCTCCAATAAAGAGACCAAGGGAATCTTTTGA
TGGTGGGGATTTTGATACTAGGCTGAAGTTTCCAAGAAAA
GAAGAAAGGAAAGAGCCACCAAATGCCCTGATGAAGCTAA
ATCAACTGCGTCCTGGGACTGTTTACAAATTGGCATCACA
GACTGGGCCTGAACATGAGCCTCAGTTCTCAATGACTGTA
GAGGTGGATGGGGTAACATATGAGGCAACAGGCCCTTCCA
AACGCAGCGCCAAGCTCCATGTTGCCCAGAAAGTACTGGT
GGCGTTAGGTGTACCTCTGCCATCAGAGACCAAGCCGGCT
GAGGAAAAGAAGAGCCAGTCTGTTTCCACTCCTGCAGCCA
CTGCTTCAAGTGAAAACACTCCCACAGGCTCTGATGACGG
CGCTGAGGTTAGAGTCTAAAGTAGGGCTGGTCCAAATACC
AACTTTTTGAACTTCGAAGCTACTGTAGTAATCAACATCG
AATGTTTGAAGCTTCAGAAGGTGGGGGCTGAACATTTTCT
TATCTCTAATAAAAGCTGGAATCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations