ZFIN ID: ZDB-TSCRIPT-090929-17034
Transcript Name: elavl3-201
Previous Name: elavl3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036562 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036562|OTTDARG00000027253|ZDB-GENE-980526-76 elavl3|OTTDARP00000029333 elavl3-002 LG_ CR385086.20 Danio rerio protein_coding KNOWN, 1120 bp
TAGATCACTATCATCTTTGTACGTCAAGAATGGTTACTAT
AATTAGCACCATGGAAACTCAGGTGTCCAATGGTCCGAGC
GGAACCAGCCTGCCTAACGGCCCTGTCATTAGCACTAACG
GCGCCACAGATGACAGCAAAACTAACCTGATCGTCAACTA
CCTGCCTCAGAACATGACCCAGGAAGAGTTCAAGAGCCTC
TTTGGCAGCATCGGGGAAATCGAGTCCTGCAAATTGGTCA
GAGACAAGATCACAGGCCAGAGCTTGGGATATGGCTTTGT
AAACTATGTGGATCCCAACGACGCCGACAAGGCTATCAAC
ACGCTCAACGGTCTCAAACTGCAGACCAAAACAATCAAGG
TGTCTTACGCCAGGCCCAGCTCAGCTTCCATCCGCGATGC
CAACCTGTATGTGAGCGGCCTGCCCAAAACCATGAGTCAG
AAAGACATGGAGCAGTTGTTTTCCCAGTATGGAAGGATCA
TCACCTCACGCATCCTGGTAGACCAGGTCACAGGTATATC
GCGCGGGGTAGGTTTCATTCGGTTCGACAAACGGAACGAA
GCAGAGGAGGCCATCAAGGGCCTGAACGGTCAGAAGCCAC
TAGGAGCAGCTGAGCCCATCACCGTAAAGTTCGCCAACAA
CCCCAGTCAGAAGACAGGACAGGCTCTGCTGACCCAGCTC
TACCAGACAGCCGCTCGCCGCTACACTGGCCCTCTGCACC
ACCAGACCCAGCGCTTCAGATTCTCCCCCATAACCATTGA
CAGCATGACTAGTCTTGCCGGGGTCAACCTGACCGGGCCC
ACTGGAGCCGGCTGGTGCATCTTCGTCTACAACCTGTCCC
CGGAAGCTGACGAAAGTGTCCTGTGGCAGCTCTTCGGGCC
TTTTGGCGCCGTCACAAACGTCAAGGTCATCCGTGACTTC
ACCACCAACAAATGTAAGGGCTTTGGCTTCGTCACCATGA
CCAACTACGACGAGGCAGCCATGGCTATCGCCAGTCTGAA
TGGCTACCGCCTGGGCGACCGCGTGCTGCAGGTCTCGTTC
AAGACCAGCAAGCAGCACAAGGCTTGAAGGAAGGCCTAGT
CACTATTGCTCTTTAACATGCAGGGGGAGCTACTGAGCTC

elavl3 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA elavl3-003 (1) 863
mRNA elavl3-201 1120
elavl3-202 (1) 3227
elavl3-204 (1) 530
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
elavl3-201 Contained in:
OTHER elavl3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036562 (1)
  • Ensembl_Trans:ENSDART00000013717 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)