Transcript

baxa-201

ID
ZDB-TSCRIPT-090929-17023
Name
baxa-201
Previous Names
  • baxa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036551 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036551|OTTDARG00000027248|ZDB-GENE-000511-6 baxa|OTTDARP00000029324 bax-001 LG_ CR388062.19 Danio rerio protein_coding KNOWN, 1981 bp
ATATTGTCGTCACGCGGCGGAAGCGTCTTCTTCAGTTCGC
TTATTTTCATGCTAATATGGCAGCGCCGTCGGGTGGAGGC
GATACGGGCAGTGGCAATGACCAGATACTTGACTTGGGAG
CTGCACTTCTCAACAACTTTGTGTATGAGCGTGTTCGTCG
GCATGGCGACAGGGATGCTGAAGTGACCCGGAGTCAGCTT
GGGGGCGTGGAGCTGTGTGACCCCAGCCATAAACGCCTCG
CGCAGTGTTTGCAGCAGATCGGAGATGAGCTGGATGGAAA
TGCGCAGCTGCAAAGCATGTTAAACAACTCTAATCTTCAG
CCGACTCAAGATGTCTTCATCAGAGTGGCCCGTGAGATCT
TCTCTGATGGCAAGTTCAACTGGGGAAGAGTTGTGGCGCT
TTTCTACTTTGCCTGTCGCCTTGTCATCAAGGCTATTTCA
ACCAGGGTTCCTGACATCATCAGAACCATCATAAGCTGGA
CGATGTCCTACATTCAGGAGCACGTCATTAACTGGATCAG
GGAACAGGGTGGATGGGACGGAATCCGCAGTTATTTTGGC
ACCCCCACCTGGCAGACAGTCGGAGTTTTCCTCGCTGGAG
TTATCACCACAGCATTGGTGATTCGCAAAATGTGAAGTAG
CAGGAAGGTGGATAGAGCGAGAGAAAAAAGAGAGTTAAGA
CGGTGAACAGAGGGTGAAACAGACCAGCAAAAGATTAACA
GAAAGACGAGAGGGAAGAGAAAGAGTTGGAGACAAAAAGC
ATTGAGAGGTGAAACCGCCTCAACCCAATGAAAGAGGAGG
AAAGAGTGAAAGTTCAGCCAGATGTAGATGGTTCAAGCCA
CTCTTTTTTTACTCCAGAGTCTGTGCCCTTTCTTGTTCAG
CTTCAAATCTTGAATACATTTGCACTGAGAATGAGAGATT
AATGCAAAAGCGTTTAGGTTTAGGCTTCATTTTAGGTATT
TATTTTTAGTTTGGGGCTAACTGGCTATCTAGAAAAGACT
GTATCGGTATGTGATTTAATTTATTAGCATTATTTCAATT
TCCGATTTAGGACTCGTATTCTGTTTATCTTTGTCAGACA
ATTGTGCATGCAGTCAAAATTCTATTTGATAAACATTTAT
GATGTTTGATCACTAATATATATGTATTTTAACGGGAGGA
TCACACCATTTAAAAGAGAAGGAATGGCCTCGGCTGCATT
CTGATGATATTTCTCCTCACTTCCTCTTCTTTCTTGGTTC
ACAGTCTCCACTGCAAGGGCTTCCAAATGTCTGTGAGTTG
TATTTACAGGTACAAGATGAGCCTCTAAAGTTTATGAGGT
GGCGTGGCAGCAGTTGAGCGCAGCAGCCAGCCAATCAGCA
CTCTGGCTGCAGTATGTGGGAGTGTCTTAGCAAGCTCTTC
CTACAGCAGGGATGGACAAAACTAGTGACCTAAAATCATT
TTAAATTTCACTGAGCCATGCTGATCTTTTTTTACACAAC
CAAATAATTTCATTGTTGAATAATGAAGGAACCAGTTGAA
CTTTCTAAAGAAGCAGATTCATTTCTCATCTGAGATTTGA
AGAAACACCATTAGTTTGGCTGGAACTGGTGTAAAAGACG
TGTAGTGTGTAAGGGTTAGTAAACCAGGCTTACAAACAGA
TGAGTTGAGCTCTTTCTCTCAGCATAGTCTTCTCAGTACT
GTATTTTCACCATGGTTAGTCAGACCTATAATCTGAACTT
TTTTATACACTTGTTTCTTTCTCTCTTGTTTGTTTGAATA
CAGTTTCATACTCTTTCTGTTTAGGATCTTTTCTTTTCGT
TGACAGTGCCTTGGCCTTTTTATGATACTAGCCGCCACTT
TTTCATCTTTTTCTACATCTTTGTAAAATGGTATGAATCG
TGCACCCTAAGGTGGTCTACGTGCTGTGAGCCCATGAGTT
TTTGTAAGATGTACGATTAAATAATAAATTGTTAAATTGT
TTTTATGGATTTCAGTATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations