Transcript

ghrl-201

ID
ZDB-TSCRIPT-090929-16989
Name
ghrl-201
Previous Names
  • ghrl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000036512 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036512|OTTDARG00000027225|ZDB-GENE-070622-2 ghrl|OTTDARP00000029292 ghrl-001 LG_ BX936393.13 Danio rerio protein_coding KNOWN, 599 bp
GTAATAACAGAACGATACCAGATTTCCCAGGATGCCTCTG
AGGTGCCGTGCCAGCAGCATGTTTCTGCTCCTGTGTGTTT
CTCTTTCCTTGTGTCTCGAGTCTGTGAGCGGTGGCACCAG
CTTCCTCAGTCCGACTCAGAAACCGCAGGGTCGAAGGCCA
CCAAGAGTGGGCAGAAGAGAAGCTGCTGATCCAGAGATAC
CAGTGATCAAAGAAGACGATCGGTTTATGATGAGCGCTCC
ATTTGAACTGTCCATGTCTCTGAGCGAAGCTGAATATGAG
AAATATGGTCCCGTGCTTCAGAATCTTCTGGAGAATCTTC
TTAGAGACTCTTCTTTCGAGTTCTGACAAGAGTCCTACAA
AGTTCCTCCTTATAAACAATTGACAATATTCACAATTTAA
AAATGATGTCATTTATGGGTTTAACAAAATAAAGAATGAT
AAAAAAATTAATTCTCTAATTTCTATGTTCTTTATTCTGT
AGCAATTGTTACAATGTTACGTGGGTGATTAAAATCTCTT
TATCAGCATTTATTCTCTCAGATTTTAATAGTTTATTTAA
AATGCTACAAAAAATATTACATTTAATAAATTTTATTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations