Transcript

hhip-201

ID
ZDB-TSCRIPT-090929-16852
Name
hhip-201
Previous Names
  • hhip-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036355 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036355|OTTDARG00000027132|ZDB-GENE-030131-4827 hhip|OTTDARP00000029170 hhip-001 LG_ BX276105.6 Danio rerio protein_coding KNOWN, 4575 bp
ACATGTGAGTGCACTGAGGAGCATGCAACACAACTTAGTG
AACTTTTGATCACAACTGTCAACTTCTGTGCACATCGGGA
TTTAACTTTTGGTCAAGGAGACGTACTGCGATTTCTACAT
ATAATCTGATTACTTTTCTTTTTTTCTATATAATTTTTTT
TCTTTTAAAAATCGCATTAATATGCAATATCATGTTTTTT
TCCATTTTAATAACGTCTTAACCAGACCTTGTATTAATTT
ATTATCGTAATTTCTTTCTTCTTTTTTTGTAAACACCTAT
TTAGCGAGTAGTTGCTTTATCTAAATTGGTTATTCTGTAA
GAACTTTCAGGACGCGTGGGGCTGTCATTCAGCAGTCCTG
TTTATTTCTGAGCAGCCGCGTGTTTCGCGTTTGCTTTCAT
CCCTGCAAAAATGAAGCATTTGAAATTTGTGCTCTTGTTA
GCCATCGCGGCCAATTTTTGGGAATGTGGTGATGCGAAAT
TTGGCGAGAAAGGAGAATTAAGTCCAAGGAGGAGGAGATG
TTACGATGGAAGTCTGCCGAGACGCCTGAAGAAGAAGGAG
AGAAAACTGTCACTCGAGGGAAGCGGTGGAGGGGAGGTTT
GTCACAGGCTCTATCCTCGCGTGTCCTGCTGTCCGTCCAG
GAGGGCTCCGTATCAGATACTGCATCGGAAAGATGCTCGG
ACTTTCTCGACTAATAACACGGAGTGTTCTAGACTGCTGG
AGGAGATTAAGTGTGCCCATTGCTCACCAAATGCTCAGAT
GCTGTTCCATTCACCTAAACTTGAAAAAGCACCACATAGA
GAACAAGACCTACCCCGCTTATGCCATGACTACTGCCAAG
AGTTCTACTACACTTGCCGTGGACACGTACCAGAACTGTT
CCAAGCCGACGTGGATGAGTTCTGCCAGTACTATGGAAGG
ATGGATGGAGGCCTGTGCTTTCCAGATTTTCACCGAAAGC
AATTGCGGAGAGATTCCAACTACCTGTTAGATGAAAAAAC
CGAAGCGATTAACAGAAAACACAAACACAACTGCTACTGC
GCTCAGGAGATCCATAGTGGTCTTCAACAACCTGTTGGCG
TGGTGCATTGTGGAGATGGATCGCAGCGGCTTTTTATATT
GGAGAGGGAAGGCTTTGTGTGGATCCTCACACATGACATG
GAACTCCTAAAAGAGCCTTTTCTGGACATTCATAAGCTGG
TACAAAGTGGTTTAAAGGGGGGAGATGAAAGGGGCTTGCT
AAGCCTTGCATTCCACCCCAATTATAAGAAAAATGGCAAG
CTCTACGTCTCCTATACGACCAACCAGGAGCGATGGACTA
TTGGACCACACGACCACATTCTTCGTGTAGTGGAGTACAC
AGTGTCCAGAAAAAATCCAAACCAGGTGGACACAAGGACT
CCTCGGGTTTTAATGGAAGTTGCGGAACTTCACCGAAAGC
ATCTGGGAGGCCAGCTCCTCTTTGGGCCTGATGGGCTTCT
GCACATCTTTTTAGGAGATGGCATGATCACTTTGGACAAT
ATGGAGGAGATGGATGGTCTAAGTGATTTCACAGGTTCTG
TTCTTCGGGTGGATGTGGACACAGAATGTTGTAGTACTCC
CTACTCCATACCCAGAAACAATCCCTATTTTAACAGCACA
AATCAACCCCCCGAAATTTTTGCCCATGGTCTGCATGACC
CAGGGAGGTGTGCAGTAGATAAGCTCCGCATGGACACCAA
TGGGAGTCTGCTGATCCTGTGCACAGATACAGTTGGCAAA
AATACGACAACAGGCAGGATCCTACAGGTCATCAAAGGGA
AAGATTACGAAAACGAGCCATCTATGTTTGACTTGGGGTC
AAGCGGAGGTACCACCCCTGTTGGTGGATTTATCTACAGA
GGATGTCAGTCAAGAAGACTTTACGGAAGTTATGTATTTG
GAGACAAAAATGGGAACTTTAGAATTCTCCAGAGGCCTTT
AGAAGACCGATTGTGGCAAGAGAAGCCTCTTTGTCTTGGT
ACTAGCAGTTCCTGTGGTTCCTCGCTGGTAGGCCACATCC
TGGGGTTTGGCGAAGATGAATTAGGTGAGGTCTACATCCT
TGTCTCCAGCAAGAGCACAGCCAAACAGTCGCATGGAAAG
ATCTACAAGTTGGTGGACCCCAAAAGACCACAAGTTCCAA
AGGAGTGCAGAAGACCAGTAGAAGATCCAGAGATGCTAAG
CACTGCTTGTTCACGTGAATGCAAGAACGGCCACTGTACA
CCAACTGGCAAGTGCTGCTGCAATGCAGGCTGGGAGGGCC
CCTTCTGCTTACGAGCCAAGTGTGAACTGGCTTGTCGCAA
TGGCGGGGTCTGTGTGGAGCCCAACAAGTGTCTCTGCAAG
GAAGGTTTTTCTGGCAACCAGTGCAGTAAAGGAGAGCGAG
GGACAAAAGGGGACGGTGAGAAAGACAGCATCCTGGAGCA
CATCATTGACATGACGACTTACCTGCTGGACCTCACTAGT
TATATTGTTTAAAAAGCAAGGCAGGAAGCTGACTCGCTCT
TCACCATTTGGCAATGTTACGAAGGCCGTTCAGAGTTTGC
CTTCAGTACACCATCCCCAAATCTCCAACTGCCCCTCACC
TGATCCTCCTCTCCCACCACTGTTCTGTATTATGAGCCAC
AGGCTTTGATATCTCCATGCTCCCCTACACCATCTGCACT
CCCACAAACACACACATAAAACAATAACATGGTGTCCAAA
GGAACCTCAACACACTTAGCCAAAGGGGGTCGCATGTTGG
AGATGAACACAGTGCTCCTCTGTTTGGTGTGTAAGGTCAA
GTGTCCCCGCAAGAGGTCTCAAAGCACTGGAAGCCCCACC
TCGGATGTTCAGACCGACCCTAACAATTGGGATATTAGGG
TGTCAACAACGCCTCAAGTGGACAGTCTATCAAACTGAAC
TGCACCATAAAGAAACTCACTGCCACAGATTGTTCTAAGA
ACGGAGAGGAAGGAGCTGTCAGTACAGCAGCAAAACCGTA
CAACAGACTTGCTCTGTGTAGAACTGGAGAATCATATTGA
TGGGACTTGATGCCAGTTTACTTGCAGTTTAAAACCGGAT
TTGCTAAAAAAGGTCATCTATTTCTTGATACAATTGTTGA
AAGGATTAATGAGGATCCTGCAAAACTGAATATTGGTTGA
TTCCTGTTGATGTTTCATTTAGAAGAAAAAGTCAAGTGAA
ATCAATCTTTAAAGAATGTTTGGACAGTCACTTTGATTAA
CTTAATACACGAGTTAAAGACGACTGGTTTGCAGGGAGAA
ACTACCCTCGAGAGGAAAAATTGCAGTATCAGTTAACCTA
TTTCCTGTAGTTTTTCATGGCCATGCACGCTGCTTTCATT
GCAAATTGTATCCTTTATCATATTTTAAATTGTTCATCTA
TCATCTTTTGTGTGATGTAAAGCACAGAAGCTTGTTTTTA
TAAATGGAAAACCCTCGTGAGGCAATTTTAGCTACTACTA
TCGTTTTTGTCTTACATTGACTTCACAGATTATGTTTTAA
GTTCTCCATTTAACACCAAACCCTATTCAGTTTTGTCATA
TACAAAAGGGAACATGACTGGTGACTGGTGTACATTTCAT
ATAGTACTCTACAAAGTACTGCTTAGATTTGCCATTGTTT
TAATAGAGGGTTTATTTTTTTTAAGGAATAATATATGGGA
GAGGAGCAGTTTTGCATTAAGCCTGTAAATTCATTTATGT
ATTTTACTTATAGATATACAGGTTTGACATCTATAAAAAT
CTTAACTTAAAGCTATAACAGTGTTCTTTTACTTTCAAGA
GTGCTTTGACTGAAAAAAAAAACACAACCATAGATCTTTC
CTTCCAACAATGTGACATTTCTATAAAACAAAGTTCCAGC
TATAATTTGAGACTATCATTTTAGTCAGCCAGCTCTTAAA
CGAATAGGTGATGTTAAATATGCTTTGCGTCATTAAGACT
CCATAGCATCCCTTTACTTTCAGATGTTGTTGGTTAAGCT
CTCTTAAATGAGCTCTCTTCTACAAAATGCACTATAAATC
AAGCAGAAATCATCCCATACTTCAGAAAATTACCTCATCG
ACAGCGGTTCTATCACTGAATAACTGATAAGACTACATCT
AGACAACAATTGGACCCCTGTTCAACTTTATACTCACTTG
TTGTCAATGAGGTCCTTATTTACATGTTTCATTGAGCCCT
TTTTGATGTGATTCTTGTCATTGAAGGTTTACATCCCCCT
CTAAAATCAGACATATTCAGTATGATCAATAACAATCCCC
GTGCGTTTATCATGTTCTGTTCAGTGCATGTACGGAATCC
ATGCTGTAAATCTACTCTGTTATTTTAGCACTTAATGTGA
AACCTGCATTGGAGCTGCTGGGAAGGTGTGATGTGAATAG
AGTAACCCTGTTTCCTTTATTATTTAAGTAGTTATGCCTT
AAAGTTATTTAAGTTGTCTACAATGTTTTTACTGTTTATG
TGAAGAAATATGGTCATTTATTGTAAATAACTAGGTTTAT
CTTGGGTTCTTCTCAGAAATATCAATATGTTTATTAAAGT
GTATAGCATGTTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations