Transcript

cpe-201

ID
ZDB-TSCRIPT-090929-16827
Name
cpe-201
Previous Names
  • cpe-001
  • si:ch211-198g9.2-001
  • zgc:85981-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036328 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036328|OTTDARG00000027121|ZDB-GENE-090313-68 cpe|OTTDARP00000029152 cpe-001 LG_none BX119983.5,CT583646.5 Danio rerio protein_coding KNOWN, 5597 bp
AACAGGTAGTCAGGACTCGCGCAGACGCACGCATCACGTC
ACGACACAGAACAGAAACGAGAGAAAGAAGCGGACAGCGC
AGAAAACAGGACGGACATCAGTACCAAAAGACACAGACGA
GAAATACGCGACAGGCAGATAAGCGCCGAGTGTCTGGAGA
GCGATGAGGGCGGCGGTGTTTTGCGGGGCTGTGTTGATGC
TCGCACTGTCCTCGGTAAAAGAGGCTGAGGGCGAAAACGG
AATTTCCTTTGAGTACCACCGCTATGAGGAAATGAGAAAA
TCGTTAGTATCTGTGTGGCTGCAGTGTCCATCCATCACCC
GCATCTACACTGTAGGAGAGAGCTTTGAGGGTCGCGAGCT
GCTCGTGCTGGAGATGAGCGACAATCCCGGGATACACGAG
CCTGGTGAGCCGGAGTTTAAGTACATTGGAAACATGCACG
GGAATGAGGCAGTGGGCAGAGAACTGCTCATCTATCTGGC
TCAGTATCTCTGTAATGAATATCAGGAGGGCAACGACACC
ATCATTGACCTCATCCACTCCACACGCATACACATCATGC
CCTCCATGAACCCCGACGGCTTTGAGAAGGCAGCTTCACA
GCCTGGTGAGATGAAGGACTGGTTTGTGGGCCGCAGCAAC
GCTCAGGGGATTGACCTGAACCGCAACTTTCCAGACCTCG
ACCGCATTGTCTACATGAACGAGAGAGAAGGAGGAGCAAA
CAACCACCTCCTGAAGAACATGAAGAAAGCTGTGGATGAA
AACACCAAGCTGGCTCCAGAAACTAAAGCTGTTATTCACT
GGATTATGGACATTCCTTTTGTCCTGTCAGCCAATCTGCA
TGGTGGAGATGTGGTGGCAAACTACCCATATGATGAGACA
CGCAGTGGCTCTACTCATGAATACAGCGCTAGTCCAGATG
ATCTGGTCTTCAAGTCTTTGGCTAAGGCTTACTCCATCTA
TAACCCAGTGATGTCTGACACAAACCGGCCACCTTGCCGC
AAGAATGATGATGACTCCAGCTTCAAAGAGGGCATCACTA
ATGGAGGAGCCTGGTACAGTGTGCCTGGAGGTATGCAGGA
CTTCAACTATCTGAGCAGTAATTGTTTTGAGATCACTCTG
GAGCTCAGCTGTGACAAGTTTCCACCCGAGGACTCACTTA
AACAGTACTGGGACCAGAACCGCAACTCACTGGTCAACTA
CATAGAGCAGGTTCACAGAGGAGTGTCAGGATTCGTTCGT
GATCTGCAGGGAAACCCCATCTCAAACGCCTCTGTTTCTG
TTGAGGGAATCGACCACGACATCACCACAGCTAAAGACGG
TGACTACTGGCGCTTGTTGGCTCCTGGAAACTACAAAGTG
TCTGCATCTGCTCCAGGATACCTGACTGTGGTCAAGAAAG
TGGCCGTTCCCCACAGCCCCTCCACACGGCTGGACTTTGA
GCTGGAGTCTCTGGAGGAGAGGAAGGAGGAGGAGAAGGAG
GAGCTCATGGACTGGTGGAAGATGATGTCAGAGACGCTCA
ACTTCTAACTCAAATACATCACAACAGTTTATGGGTGTAA
AATATTTATTGTTGTCGTGTGTGTGTGCTCATCAACTTAA
ACAGCATAGAGTTTTTTTAGGGATCGTTTTACGCTAGAGG
CACTGCGTCCAGACTTATTAACATTAGACATTTGCACATT
CAAGTGGTCCTTGATTATGATTTGATTTTTTAATCTAAAA
CTGGGGTGTATTAGGGTGACACGGTGGCTCAGTGGTTAGC
ACTGGCGCTTCAGAGCAAGAAGATCACTGGTTTGCGTCCC
GGCTGGATCAGTTGGCATTTCTATGTGGAGTTTGCATGTT
CTCCCTGTGTTGGTGTGGGTTTCCTCCGGGTGCTCCGGTT
TCTTCCACAGTCCAAACACATGCGCTATAGGTGAGTTGAA
TCAACTAAATTGTCCGTAGTGTATGTGTGTGAATGAGTGT
GTATGGATGTTTCCCAGTACTGGGTTGCAGCTGGAAGGGC
ATCTGCTGTGTAAAACATGCTGGATAAGTTGGTGGTTCAT
TCCGCTGTGGTGACCCCTGATGAATAAAGTGACTAATCCG
AAGAAAAATGAATGAATGGTGTGTATTATTGCAGTTTGAG
CATAAACAACAGACTGCAATTTAATGATGCTCAAAGGGAG
ATACACTAGATAAAGTGATTCATTTTTTAAAAAGAAAGTA
AACCCGCTGCCCTAAAAGTGAGTAATCCCATTGTAACTTG
GAACTGTTGAGTTGACTTAACTTAATTTTTATAATTATTA
GGGATGTAACGGTATTGTAAATACCGTCATACCGCAATAT
TAAATTTTTTCGATAAAACTATAGGTCTTCAGAGAAAATT
TGCTCAGGCGAATGAAGCGAACGGGAGGTAGCTGAAACTA
CATTTCCCATCAGCCCAGGCGTGGCCATAATCCTTTGCGG
TCTGTTGTCGCTACAGATCCAGTAATGCGGAAATGGAGTG
TGCTGCTAGTAGCGGAGATGAAAAAAAGATGGAAATGATC
GAACCTAAAGCGGGTGTTGTCGCCGCGCGCGTGCTGAATA
GCGGTGCTGTCGCGCGCGTTCTGATCAGCTGTGTTGTGGC
GCGCGTATTGTAAAGCGCCGAGGGGGGGTTGAGCGCGCAT
ACTCAAGAGAGGTGTTTTCGCGCGCCTACTGAAGGGCTGG
ACTGGACGGAGGTTGTGTCGCGTCGCGGGGGCACTTTTGA
TCGTTTTGGAAGGGCATTTTCTATCCAAAACTAAAAAGGG
CATGTGCACTGCACAGGTTGAGCCCTATGTGTGCACGTGC
CTGCAAGTTGGGGAATACGACTAATAACAGTCATGGGGAC
TGCAGAAACACAGCACACTGTTCAGATTGATGCAGACATT
GACTTGTACCGCAAAGAGACCCTCTATCTTACTCATGGTT
TGTCCTCTCAAGTGGGGGAAAGACAATGCACAACGTTACC
CACTGCTGTCAACATGGGCCAAGTCATATCTCTCTTGTCC
CAGAAACCTCATTCCCAAATGAGAGGGTTTTTTTCTGTTG
CAGGGGACATTGTAAATACCCAGAGATACCAGCTTTTACC
AGATTATATTTATATGATAATTTTCCTTTAAACCCATCTC
TATCTAAGTGAGTGATTAAATGTTAAATGTGATGAGTTTT
CAACAATACTAAATTGAAACTTTATTTTTTTACATGGTTT
AATAATTTTTTGTTATTAAAATTGAAGTTCCTGTTTCAAA
GCTAACAGATAGATGGCTAATTTGTATGTCATTGACACTT
TTGGCACTTTTTTGGAGTATTTTCAAAAGTTTTTTTTTTA
CCGTGACATTCATACCGAGGTATTACCGTACCGTGAAATT
CTGATACCGTTACATCCCTAATAATTATGCATGTTGTTTA
TTTACTTAATAATTTTAAGCTGATGAGTTTACTCAGTTTT
TTAAATAAAGTCAACTCGTCGCTTTAAAGCAGTCCCTGCA
GGCACAGGACATCAACATGACGTCATATTGGCGTTGTACC
CTAGTGTTGTGGGGATATTGGATTTTGTTTGGAAATGAAA
ATCAGGTTGACGTCAGAACCCAGCGTCAGGTCGATGTCAA
TGTCCAACCTAAAATCAACCAGATATTAACGTCTAATCAT
GTTACACATTGAAGTTGTGTGGACGTTACCACTATGACAT
CTATCAGACGTTGGATTTTGGTCACTTTCCAACACAACCT
AAAATTAACCAAATATCAATGTTATTTGACGTCGTTATTG
GACGTAAAAATAACGTTCTCAGATGCTGCCTAGATATTGA
ATTATGATCACCTGACGTCATCACCTAAATGTAACCTAAT
ATTAACGTCTAATGATGTTGTGTGCCTGCTGGGGCATGTT
TACTTTCCTTCTAAGTGATCTTATTTTACGGTGTATTTTC
TTATGCAGACTATAGAAGAAATGGCAGGTAAGGACAACGG
CAAGATTCTTCCTTTATGTAAATTTTAGAGTTAATGATGT
AAACCCATTATAACATTACTAACCCTAAAATTTACATAAA
GCCTACCCCAGGTGTGGCATTTTCTTCAAATGTCCACTTG
AGCAGCTAGTGAATCAGCACACACTAGGCCAGCTGACCAA
TCAGAGCCCATTGTGTTTTTGTGAGGGAGGGGCTTCAGAA
AACTAGACAGTCAACAGACTTCCAGAAGAGAATAGAAACG
GTAAAAAAACGTAAAATATGTTAAATATATTAACCAAAGG
GCGTCACGGTGGCACAGTGGGTAGCATGATCGCCTCACAG
CAAGAAGGTGTCTAGTTCGAGCCCCAGCTGGGTCAGTTGG
CATGTTCTCCCCGTGTCCGTGTAAGTTTTCTCCAGGGTTT
CCTCCAAAGACATGCGCTATAGGTGAATCGAGGAAACTAA
ATTCTCTGTAGTGTATGTGTGTGAATGTATATAGGTGTTT
CCCAGTGTTGGGTTGCAGCTGGAAGGGCATCCGCTGCGTA
AAACATATGCTGGATAAGTTGGAGGTTGATTCCGCTGTGG
CAACCCCTATCCTTGTAAATATTTATGTTTTACGCTAAAG
ATATGCAAGTCTGATGAAGTGCTGCTAATGTAAAGGTGGT
CCTATTGCAAGTTTTATACACATTGTGTATCATTACCACA
TATAAGAAATGAAGATATCTTGTAGGATGTTTAACCAATC
TGTTCTTCATTGTGTTTAACATTGATATTGTGAGGTTTGT
TTTATTTTTTTACTATGGTTTATTTGTAGCTAGGATCACC
AATCTCACCAACCAATCAGAGAGCACTGTGTCGTGATGAA
TGTACGTGTCAGCAGTTTATTCTGATTATGAAAGCACTCA
TTTACACCCAATCACACGTCTCTTTCTGTTCAAACTCTGT
GTGGGTTTCTGCTTGATGTTTTGAACGGGAGTGCTTTTGA
TAAACCCTTCATTTGCTGATTCTTTAACACTTACAGCTTT
GATTATCGCATCAGATAATGAAAAAAATGGAAGAGGTTAT
CAACTGAACTCCTACCTTGTGTTATAAGAACTATATAGGA
AATTAAATAATTATAAACATATGATAGATTATAGCTATAA
ATCAGTATTATTTATGTTTGTTGAGCAGAGAGTTTCATTT
CAGATCATATAACGGCAGATTTTAACAGCACAAACTAAAC
GAATAGAGGTTATTTAGATCTGGTGGTTTTGTAATCTATA
CCAAAATGCACAATCTGTGATGAAGTACTATCTGCAGTCT
TTATTACACATTCTGTAATATTTATTGTCTTTTTTGTCTG
TTTAAGTATCTTTATAAGTAGTGTTTTTGTTCTGTATTAT
GAAATGGCACGCTAATGCTACATCAATCATCGTTACGATC
AAGTCTATAGTCACAATTTCTCATTGTTTCAACAGTTTAT
CCTCTGATTTTTGGGATGATCATGCTCATTTTGATTAAAC
TAGAGGCTTAAACCTTAAATATTATTAGCATTTCAAGCCA
GCTTATATATTTCTCCTTTGAAACTTCAGTGGTATGTCTT
GTATATGAATGTATCGAAGGTTTATTAAATGGAATGACGC
AATTCACAGCCAAAATAAACTTCCCTTTCTGTTGTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations