Transcript

rag1-201

ID
ZDB-TSCRIPT-090929-16801
Name
rag1-201
Previous Names
  • rag1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036299 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036299|OTTDARG00000027105|ZDB-GENE-990415-234 rag1|OTTDARP00000029129 rag1-001 LG_ AL935203.12 Danio rerio protein_coding KNOWN, 4485 bp
GGAGCACCAAGCAACTGAGATCCAGCCAGGCACTCTTAGA
TAGAGGGCCTGAAAGACATCCACACTCAAAAACGCACTAG
GCCTCCCTTGTGCCCCCATGCGGAAAGGCCCCAGGGGAGA
TTTCGCCAGCTGAGCCTCAAAAACAAGCAGAGAATAAGCT
GACGCCATGGAGAAAGGGAGGTGGAGTTCTGAAGATGCTC
CCAGAGCCTCCATGCCTGACGAACTGTCTCATCCTAAGTT
TTCGGAATGGAAGTTTAAGCTCTTTCGGGTCAGGTCCATG
GAGAAGGCCCCTGTGCAAAATGAAACACCGGTGGAGAAGG
AAAACCAGCCTGAGCTGGCAATGGAGAAGACAAGCTCTCA
AGGCAGTGTTATGAGGCTCTGTTTTGGAGGGAAGAGCAAA
GAAAATGTGGAGAGTGCTCGAGGGAGAGTGGACCTTAAGC
TACAGGAGATTGATACACACATGAATCTTCTCAAAAACAT
GTGCCGCCTTTGTGGCATTGCAATACAGAAGGCTAAAGGT
CCATCACATGAAGTTCAGGGGGTTTTGGAGGAGTCAAGCA
GATGTGCCTTACGCAGGATGGGCTGCAAGCTGGTGACCTG
GCCGGAGGTGATCTTGAAGGTCTTCAAGGTGGATGTGACA
ACCGATATGGAGACGGTTCATCCGTCTTTGTTTTGTCACA
GGTGCTGGACTGCTGCCATAAGGGGAGGGGGTTTCTGTTC
CTTCACCAATACCCGAATCCCAGACTGGAAGCCCCACACC
TCTCAATGCAACCTTTGCTTCCCTAAAAAGAGCTCTTTTC
AGCGGGTAGGAAAGAAGCGGACTAAACCACTTAAAAGTGC
ACACATCCTTCCTAAGAGATTCAGGAGGGACTCGTCAGAA
TCCTCAAGAGTGTGGAGACAGACCACAGAGAATCCAGATG
GGAAAGAATGGTTAAAACTATCAGTTCAGAGAGGACAGTG
GGTAAAGAATATCACACGGTGCCAGAGGGACCATCTGAGC
ACTAAGCTCATCCCCACTGAAGTCCCAGCAGACTTGATAC
GCGCAGTTACTTGCCAAGTGTGTGATCACCTGCTTTCTGA
CCCCGTCCAATCACCATGTCGACACCTGTTCTGTCGGCTG
TGCATTATAAGGTACACCCATGCTTTGGGCCCAAACTGTC
CCACCTGTAACCAACACCTGAACCCATCTCACTTAATCAA
GCCAGCAAAGTTCTTTCTTGCAACCCTCAGCTCTCTCCCC
CTGCTCTGCCCCAGTGAAGAATGCAGTGACTGGGTTAGAT
TTGACTCTTTCAGGGAACACTGCCTTAACCATTACCGCGA
AAAAGAGTCCCAGGAAGAACAAACACCTTCAGAGCAGAAC
CTTGATGGTTACTTGCCGGTCAACAAAGGTGGGCGTCCTC
GACAGCACCTGTTGTCACTGACCCGTCGGGCTCAAAAACA
CAGACTACGAGACTTGAAGAACCAGGTGAAGACATTTGCC
GAAAAGGAAGAAGGAGGGGATGTGAAGTCTGTGTGTTTGA
CGCTCTTCCTTCTGGCATTGAGAGCTGGGAATGAACACAA
ACAAGCAGATGAACTGGAAGCAATGATGCAAGGCAGAGGA
TTTGGTCTGCATCCTGCAGTGTGTTTGGCCATAAGGGTAA
ACACCTTCCTCAGCTGCAGTCAGTATCACAAGATGTACCG
CACGGTGAAAGCCACTAGTGGCCGCCAGATATTCCAGCCC
CTGCACACTCTGCGTAATGCAGAGAAAGAGCTTCTCCCTG
GGTTCCACCAATTTGAGTGGCAGCCTGCTTTGAAGAACGT
TTCGACCTCCTGGGATGTGGGCATCATTGATGGCCTCTCT
GGTTGGACAGTCTCTGTTGATGACGTCCCAGCAGACACCA
TCTCCAGACGATTTCGTTATGATGTGGCATTGGTTTCTGC
ATTAAAAGACCTTGAGGAGGACATAATGGAAGGACTAAGA
GAGAGGGCGCTGGATGACAGCATGTGCACTTCTGGCTTTA
CTGTGGTGGTCAAAGAATCATGTGATGGTATGGGAGACGT
CAGCGAGAAGCACGGATCTGGTCCCGCAGTTCCTGAGAAG
GCAGTAAGGTTTTCCTTCACAATTATGTCCATCTCTATTC
GACTTGAAGGGGAGGACGATGGCATCACCATCTTCCAGGA
ACAAAAGCCCAACTCTGAACTCTCCTGTAGACCTCTGTGT
CTCATGTTTGTGGACGAGTCTGACCATGAGACCCTGACAG
CCATCTTGGGACCTGTGGTAGCAGAACGGAAAGCCATGAT
GGAAAGTCGGCTCATCATTTCTGTTGGTGGTCTGCTACGC
TCTTTTAGGTTCTTCTTCCGGGGCACAGGCTATGATGAGA
AGATGGTCCGTGAAATGGAAGGCCTGGAAGCATCGGGCTC
TACTTATATATGCACACTTTGTGACTCAACACGTGCTGAA
GCCTCTCAAAACATGGTGCTGCATTCCATCACACGCAGCC
ATGATGAAAATCTCGAGCGCTATGAGATCTGGAGGAAAAA
TCCCTTCTCAGAGTCAGCAGACGAACTGCGTGACCGAGTC
AAAGGTGTTTCTGCTAAGCCTTTCATGGAAACCCAGCCTA
CTCTGGATGCACTGCACTGTGATATTGGCAATGCGACTGA
ATTCTACAAAATCTTTCAGGATGAGATTGGAGAAGTCTAC
CAGAAGCCCAATCCGAGTCGAGAGGAGCGCCGCCGTTGGC
GGTCAACCCTGGACAAGCAACTAAGAAAGAAAATGAAACT
CAAGCCTGTGATGAGGATGAATGGAAACTATGCTCGTCGG
CTGATGACACGTGAAGCGGTGGAGGCTGTTTGTGAGCTGG
TTCCTTCTGCAGAACGACGTGAGGCTCTATTGAAACTGAT
GGACCTCTACTTGCAGATGAAGCCTGTATGGCGGTCAACT
TGTCCCTCCAGAGACTGCCCTGACCAACTCTGTCAATACA
GCTACAACTCTCAGCAATTTGCTGACCTTCTATCCTCCAT
GTTTAAGTATCGATATGATGGAAAAATCACCAACTACCTC
CACAAGACCTTGGCCCATGTTCCTGAAATCGTTGAAAGAG
ACGGGTCTATCGGAGCATGGGCCAGTGAAGGGAATGAATC
TGGGAACAAGCTCTTCAGGCGTTTTCGGAAGATGAATGCA
AGGCAGTCCAAGACATTCGAACTTGAAGACATATTAAAAC
ACCACTGGCTCTACACTTCCAAGTATCTTCAGAAGTTCAT
GGAGGCTCACAAGAATTCAGTAAAAGCAATGCAAGCCACA
ATTAACCCTGAAGAGACTCCAGAAGAAGCTGATAACAGTC
TTGATGTTCCAGATTTTTAAGTTTATCTTTGATTGACTTT
CTTTAATGGACCCTTTTTCTTGCTAATGAAAATATTAAGT
AATTGATTTCATTTCTTGAGATGAGATGTAATATCACATC
TAATGACTTTATTATTCACCTCATTATTTTTTGAAGCTAG
TGCATAAATGTGAGCTAAATTGTTTTATGGCGGAGATAAA
ATTGTATGGGCAGGTTTTTTTTCCCTCCCCAGCTTTTACA
GGCAAATTGACTTGATTTTATCACTTGCTGCTTGTGAAAT
ATGAGGGATTTTATTGTATTGCCAGGCTGTGACACCTTCA
CGAATTCATGCAGAAGGGTTATTTATGAAAACGTACGAAG
GAGTTGTAAGTCACTGAAATTATATTAAAGGAGCCCCACG
TTTATGATTGCTATATTAATATTTCACACAGGACAGAGAC
AAAGTGAAATTAGAAAATGTTAAATTTGCAGGAGGTTTAG
AGGAAACAGGGTTATTTTACCAATGCATTATTTTGATGGT
GCTCAAATGGTCAACAAATGACTGAAATGCAAATAGACAC
TATGCTACAGCATTTGCACATTTATGTAGATCACCCCATA
ATCTACCTCAGTCTTACTGGTCCCACAGGGAATTTGCACA
TATGTGCTGTTCACACAAACAAAGATTCAAATATTTTTAA
AGAAATAGCCATGTCTTTGACACAATAACACCTGCTGACT
ATTGTCAGAATTTCTTTCTTGTTGTGTTTAAGTGAGGAGA
TAAGTGGTCTATTCACATCAAACTTGTAGCTCAATTTATT
ATTTAATACTTTGTTAATTGTGCTCTCTTAAACAAATGTA
TTTCTTTGTGAATTGATTTAGCTGATTTCTTTGTCTTGGT
TTTAATGTTTACCTAATGTATTTCTTTGTTCTAAGTAAGA
TCACATTACTTGGTTTGAATTTTTGTTTCAATTAAAACTT
AATAGTGTGGTTAAAACTTGTTTTAATTGCTTGATGTTCT
TTTTAATTTAAAATAAACACTGCTCATAATTATAAACATA
ATTGTTTTATAGACTTGCACAAAAGCACTGGTAATGCTAC
CTGACCCATTGTATGACTTTCTTTCATTGTGCGAGAACAT
TACCGTGTAATAGATTGTTGCAATTAATAAACTTTTGGAT
TTATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations