Community Action Needed: Please respond to the NIH RFI
Transcript

ednraa-003

ID
ZDB-TSCRIPT-090929-16741
Name
ednraa-003
Previous Names
  • ednra-003
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036237 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036237|OTTDARG00000027076|ZDB-GENE-010906-2 ednraa|no_translation ednra-003 LG_ CR762429.11 Danio rerio protein_coding KNOWN, 391 bp
ACACACATACAGCAACTCTCCACAGGAAAAGCTGGAGACA
GAATGCGCAGCCCCTTCACAGCAGCTTTGGTGCGTCGTGG
CGTCCAAATGGGATTCTGCTAGACTTTGATAGTTGGTTAA
TTACTCATATGATACCACACAGATGTCTGGGGGGCTCTAG
CCGAATATTCGTCTCTCACTAACTCACTGACTGACTGACT
GACGGGATCCTGGGGAAGGCAGACATTTAAGGAGCGCTGC
TGGTCACAAAGTGGCCATTTGATGACAGCTCCTTTGGACT
CTTCCTGTGCAAACTTGTGCCATTCCTCCAGAAAGCGTCT
GTTGGGATTACAGTGCTCAATCTATGTGCTTTGAGTGTGG
ACAGGTACAGGGCTGTAGCCTCCTGGAGCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations