Transcript

tm9sf2-002

ID
ZDB-TSCRIPT-090929-16734
Name
tm9sf2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036226 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036226|OTTDARG00000027070|ZDB-GENE-030131-6302 tm9sf2|no_translation tm9sf2-002 LG_ BX088652.6 Danio rerio protein_coding KNOWN, 706 bp
TACGATGTGGAGGACAATCAGAAGTTCTGTAATCCTGGCT
TTCCCATTGGTTGCTATGTCACAGATACAGGACGGGCCAA
AGATGCCTGTGTGGTCAATGCTGACTTCAATGACAAAGAC
ACCTTCTACATCTTCAACCATGTGGACATAACAATTTTCT
ACCACAATGTGGAAAATGAGGTTGCTGGTGCCAGACTGGT
TGCAGCTAAGTTAGAGCCCAAAAGCTTTAAGCAGTCCAAC
GTAGACAAACCAGACTGCACAGGACCTCCCATGAGCCTGA
GCAACAAGTTCAATGGAGAAATCAGGATACCCTACACTTA
CTCTGTCAAGTTTCTGGAGGATAAGACAATTCGCTGGGCC
TCCAGATGGGATTACATTCTTGAGTCTATGCCACACACAA
ACATTCAGTGGTTCAGTATCATGAACTCTCTGGTCATCGT
ACTCTTCCTCTCTGGAATGGTCGCTATGATCATGCTTCGA
ACACTTCATAAAGATATCGCTCGATACAACCAGATGGACT
CTGTGGTGAGTTCCACTCTACAAGATTACATCATAATCTT
ATATGATCTGTATATATGTTTGTGTGACTGTTGTAGTTTA
TGCATTTTAGTACAGCCAACATTTTGTCTTTCAGGTGATT
GATCATATTTATGTATACATGTGTTTGAGTCTGTCTGTGG
TTAATCAGCATAATGGCAAAAGAATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations