Transcript

tm9sf2-201

ID
ZDB-TSCRIPT-090929-16733
Name
tm9sf2-201
Previous Names
  • tm9sf2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036225 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036225|OTTDARG00000027070|ZDB-GENE-030131-6302 tm9sf2|OTTDARP00000029072 tm9sf2-001 LG_ BX088652.6 Danio rerio protein_coding KNOWN, 3051 bp
GTCAGATGCTGCTACGCAGGCAGCGGTTACGCTAACGCTT
GTGCTTAGACATCACCAATGTCTAAATTTTGACACCCATA
TCTACATTTCACGCATGTAAATACATCTACAGATTACTTA
ATTAGTCGGTCGTGGCAAAATGGTCGAGTTCCACCGTGTC
CGTGTTGTATTTGTGTCGCTTTTCGTGTGCGGGTTGTTGC
GGGACGCGTTGAGTTTCTATCTTCCTGGTTTGGCCCCGGT
CAGCTTCTGTAAGAAAGAAGCGGGCGACAAAAACAGCGAA
GTCCCAGACTGCAAGTCAACCATTGAGCTCTTTGTGAACA
GGCTGGATTCTGTGGAGTCAGTTTTACCCTATGAATATAC
TGCGTTTGATTTTTGTGCTGAGCAACATGAGAAGCGACCA
TCTGAGAACTTGGGCCAGGTATTGTTTGGTGAGAGAATTG
AGCTGTCCCCATATAAGTTTTTGTTCCAGAATGATTTGCA
ATGCCAGTCCGTCTGCGTCAAGTCTTACAAAACACAAGAT
GCAGGTGATAAAGCCAAATTGGATTTCCTCAAGAAGGGAA
TGCTCCTCAATTACCAACACCACTGGATTGTTGATAATAT
GCCGGTGACCTGGTGTTACGATGTGGAGGACAATCAGAAG
TTCTGTAATCCTGGCTTTCCCATTGGTTGCTATGTCACAG
ATACAGGACGGGCCAAAGATGCCTGTGTGGTCAATGCTGA
CTTCAATGACAAAGACACCTTCTACATCTTCAACCATGTG
GACATAACAATTTTCTACCACAATGTGGAAAATGAGGTTG
CTGGTGCCAGACTGGTTGCAGCTAAGTTAGAGCCCAAAAG
CTTTAAGCAGTCCAACGTAGACAAACCAGACTGCACAGGA
CCTCCCATGAGCCTGAGCAACAAGTTCAATGGAGAAATCA
GGATACCCTACACTTACTCTGTCAAGTTTCTGGAGGATAA
GACAATTCGCTGGGCCTCCAGATGGGATTACATTCTTGAG
TCTATGCCACACACAAACATTCAGTGGTTCAGTATCATGA
ACTCTCTGGTCATCGTACTCTTCCTCTCTGGAATGGTCGC
TATGATCATGCTTCGAACACTTCATAAAGATATCGCTCGA
TACAACCAGATGGACTCTGTGGAGGATGCCCAGGAGGAAT
TTGGCTGGAAGCTGGTTCACGGAGATGTCTTCAGGCCGCC
TAGGAAAGGCATGCTGCTGTCTGTGTTCCTTGGTTCTGGG
ACTCAGATCTTCATCATGACCTTTGTCACTCTATTTTTTG
CCTGTTTGGGTTTCCTGTCACCTGCCAATCGCGGGGCTCT
GATGACGTGTGCAGTGGTGCTGTGGGTGCTCTTGGGTACT
CCAGCTGGTTATGTGGCTGCTCGCTACTACAAATCTTTCG
GTGGTGAGAAGTGGAAGACCAATGTTCTGTTGACAGCTTT
TCTCTGTCCAGGAGTGGTGTTTGCAGATTTCTTTGTGATG
AATCTCATTTTGTGGGGTGAGGGTTCATCCGCTGCCATGC
CCTTTGGCACTCTGGTTGCCATCCTGGCTCTGTGGTTTTG
CATATCAGTGCCCCTCACCTTTATCGGCGCGTACTTCGGT
TTCAAGAAAAGCGCCATTGAACATCCTGTGCGGACCAACC
AGATTCCAAGACAGATTCCAGAGCAGTCCTTCTATACTAA
ACCTCTTCCTGGCATTGTCATGGGAGGAATCCTGCCATTC
GGATGCATCTTCATCCAGCTGTTTTTCATTCTCAACAGCA
TCTGGTCTCACCAGATGTACTACATGTTTGGCTTTCTCTT
CCTGGTCTTTATCATCTTGGTCATCACCTGCTCTGAGGCC
ACCATTCTCCTCTGCTACTTCCACCTGTGTGCTGAGGACT
ATCACTGGCAGTGGCGTTCTTTCCTGACCAGCGGATTCAC
AGCTGTTTATTTCCTGGTCTATGCCATCCATTACTTCTTC
TCCAAGCTGCAGATCAGCGGACTTGCCAGCACCATTCTTT
ACTTTGGTTACACCATGATCATGGCGCTCATCTTCTTCCT
CTTCACAGGCACCATTGGATTCTTCGCTTGCTTTTGGTTT
GTCACCAAGATCTACAGCGTGGTCAAAGTGGATTAAATGA
AAGCAATCTCAGATGAGACTGAACTTCTCTTCTCCGCCCA
ATGTGAGATCCCAGAGGGAGGGACCTGAGCGCTGTTTATC
TTCTGTTGCCACGGCAACCCTTCTTTACATCAGCAACTCT
AAATCTACAAATTTAATTTACTTTGCTGTGTGTGCGTGTG
GGCGTGTGTACATTAGTAGTGCATATTCAACCAATTGGAA
GAACTCTACACATCTGCTTCTTTAGTTGGAACAGAATACA
GCAGATACACACATTGACCCTTATAACTCACATGGGTATT
TACGATTTGGAGTTGTCATTTGTAAATATTACTTACTTTA
TTCTTTGCTAACGTTCAAATGGAAGGGTAATGCATAAATC
GCAGAGAAAACTAGCTCCAGTCATTGAATCTTCAAGGTGT
CGGAAGTATGATTTTGTAAATATCTTCTTTTGTTTCTTAA
ATTCATCAAGCAAGAAAGTAGAAGTTGAAAGCCGAAGGAC
TTCATTCTTTGGGTTGATTTAAGAGTGAGGCTGTGTGAAT
TTTCTTTTTTTCCATCTTGTTGATACTGTACAATTACTGC
TTGCGTATACTTGTGTATAACCAGTGGGGGGAATGTCTAT
TTAACTTTTTTGTTTGGTCATTTTTTCTTTGTTTTCTGTT
TATGCCTCAACACTTTGTGTGCCTCATTATCACAGAGGAA
AATCAAGACTGGTAAAAACTGATTTGGGAAGATGTGAAGT
GCCCCGTCCATACACAGGGGTAACTGGAGTGAAATGATTT
CTTTTGTTTGTATATATGCACAGCGTTAAACGTGTGTCCA
GCATAAACTACATTAGCTTGGTTGGCTACTCGGTTTTGGT
TTTTGTCTTCTCTGATTTTGAGGTAATGAGATTACAAGAA
AAATGAAAAAAAAAAATTATTAGAAATAAAACCTTGTCTT
CAAAAATATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations