Transcript

pcca-201

ID
ZDB-TSCRIPT-090929-16728
Name
pcca-201
Previous Names
  • pcca-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036220 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036220|OTTDARG00000027068|ZDB-GENE-040718-246 pcca|OTTDARP00000029068 pcca-001 LG_none BX088652.6,CR391947.14 Danio rerio protein_coding KNOWN, 3010 bp
CGCGCCGCTCTCCTCTCAGCAGCTCTCCGACTATCATGGC
GGCTTACAGAAGCGCTGCAGGCTTTCAAAGAGTTTTGCAT
GATGTTAAGCATGTGTGTTTTAAGCAAAGGTGTGGTGTTA
TAATCTGCCGGTACTCTACTGTGATTGAGCCTAATGACAA
GACCTTTGATAAAATCCTCATTGCAAACAGAGGCGAGATC
GCCTGCAGGGTGATTAAAACATGTAGGAAGATGGGCATCA
AGACGGTTGCAGTTCATAGTGATGTGGACTCCAGTGCGGT
TCATGTGAAAATGGCAGATGAGGCTGTGTGTGTTGGTCCT
GCTCCTACCAGTAAAAGTTACCTGAACATGGATGCTATCA
TGAATGCCATCAAGTTGACTGGAGCACAAGCTGTTCATCC
AGGCTATGGATTCCTGTCTGAAAATAAGGAGTTTGCCAAA
AGATTGGCGGCTGAGGGGGTGACCTTCATTGGTCCTGACA
CTCATGCCATCCAGGCAATGGGGGATAAGATCGAGAGCAA
ACTCATCGCCAAAGCTGCCAAAGTCAACACCATCCCTGGC
TTTGATGGGGTGGTCAAGGATGCAGAAGAGGCTGTGAAAA
TAGCAGGAGAGATTGGTTACCCTGTTATGATCAAAGCATC
TGCTGGTGGAGGAGGTAAAGGGATGAGGATTGCATGGAAT
GATGAGGAAACCAGGGAAGGCTTTCGTTTCTCTTCTCAGG
AGGCGGCATCTAGTTTTGGAGATGACCGTTTGCTGATTGA
GAAGTTTATAGACAATCCCAGACATATTGAGATTCAGGTG
TTGGCGGACAAACACGGCAATGCTCTGTGGCTGAATGAGA
GAGAGTGCTCTATCCAGAGAAGAAACCAGAAAGTGGTAGA
GGAGGCACCCAGCACTTTTCTGGACCCAGACACCCGGAGA
AAAATGGGCGAGCAGGCTGTGTCTCTGGCAAAAGCAGTGA
AATACTCTTCAGCTGGCACTGTGGAGTTTCTTGTTGACTC
TAAGAAGAACTTCTACTTCTTGGAGATGAACACACGTTTG
CAGGTGGAACACCCCATCACAGAGTGCATCACAGGGCTGG
ATCTTGTGGAGCAGATGATCCGCATCGCAAAGGGAAACAA
ACTTCAACACAAACAGTCTGACATACCCATAAATGGCTGG
GCCATCGAGAGCAGAGTCTATGCTGAGGATCCATACAAAT
CATTTGGACTCCCCTCCATCGGTCGACTGTCTCAGTACCA
GGAGCCACTTGACTTGGATAATGTTCGAGTGGACAGCGGA
ATTCAAGAAGGAAGCGACATCAGTATTTATTATGACCCTA
TGATTTCTAAGCTGGTCACGTATGGCAAAACACGGGAGGA
AGCTCTGAAGAAAATGGAAGAAGCACTTGATAATTACGTG
GTCAGAGGTGTAACACATAACATACCTCTACTGAGAGAGA
TCATTGTTCATCCTCGGTTTGTGTCTGGTGATATCAGTAC
TAAGTTTCTCCCGGAGGTGTATCCTGATGGGTTCAAAGGT
CACATGTTAACAGCAGGAGAAAGACAGGAGCTGCTTGCTA
CGGCTGCGGCACTCTATACAGCAGCACAGCTCCGCTCTCA
GAGGTTCCTGGGGGATCTCAGGGTGTCTTGTGTTCCTGCA
GAGAGCAGTGATTGGGAGTTGTGTGTAGAACTTGAGAAAA
GTGTTCACATGCTGGGCGTGTCTCGGTCTGGAAACAAATA
TACAGTGGAGATAGATGGAGAAAAGGTTCAAGTGTCTGGA
GAATGGAACTTGGCCTCAGCATTGCTGTCCGTCACCATCA
ACGGCAAACACAGGACTCTTCAGTGCCTGTCACGGACAGC
GGCTGGAGAAATCATCTTGCAGTATCTGGGCACTTCATTT
AAGTTGCGTGTGCTGAGTAAACTGGCAGCGTCTCTCAGTA
AACACATGCCGGAGAAGGTTCCAGAAGACACCAGCAGCAT
CCTCCGCTCTCCAATGCCAGGATCTGTGGTGGCGGTATCC
GTTAAACCAGGGGATACGGTTGCAGAGGGACAGGAGATCT
GTGTGATTGAAGCTATGAAGATGCAGAACAGCATGACCGC
AGCCAAGACGGCCAAGGTGAAGAGCGTGCATTGTAAAGCT
GGAGATACAGTTGGAGAAGGAGATTTACTGGTGGAACTGG
AGTAACATCTCATCTGCAGGCATTAAAAAGGCCATCAGTT
GCTGTGGATGAGGAAACAAAGACACTAATAGAGTAGATGG
AACATTCCTCCACATGTCCTTTGTTCCCCTGTGGTCTCTT
TTTTACATTATGACTGTAATACATCCATCTCACTGGAACT
GCTTTATTCCAGGGAAAGAAATGTCAAAGCGATAACATTC
TCTTGTGCCTTGGCCTTCCATTGGAGGTTTTCTTGTTTCA
CATGGAATCAACCACAGTTTGACATCATCATTTGTGATTG
TTTTAACGTATCTTTAAATACAGTCAACGAAAACTGTTGA
CACACTCCTTCCCCCTCACCTCGGTGCACATTTAGCATTG
TTCAGAGGAAGTGCTGTGAATGTTTGCCATTGCTCCAACT
CAGTTATTTTAATTATTAGGTTGTTGTATGCAATGAATTT
TTCTGTTACATGATTATGCAAACACAAGTGTTAATATATA
TCTTTCACCTACCAATCACCATCAATCCCACACTCGTGTA
TATTTATACCACACATATTTCTGTCATCAAATGCATTAAA
TTGGTCAAGAGAATAATATGCCTACATGCATTTGTGGTTT
GTTTCTGCACAAGTTGGGTTTAAGTCTGTAGGTGTGCTAT
AGAGACAGTTTATTTGTTTCCACAATTCAAATAGAGAAAC
CCAGAGGAGTGGACCATTAAAAGATGGGAAAGGAAGATAA
TATTATGAAAACTAACAGCCAGCTGTGATCAGGCTTGGAT
ATTGTTGCTGGTTCCTGTTTATGTAGCACAAAGCCACTTA
CTGTCTGTATTTGTATTGAGAAAATGGAATAAAATGGGAT
TAATGTAAAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations