Transcript

cyp4v8-002

ID
ZDB-TSCRIPT-090929-16680
Name
cyp4v8-002
Previous Names
  • cyp4v2-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036148 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036148|OTTDARG00000027027|ZDB-GENE-061103-601 cyp4v8|no_translation cyp4v2-002 LG_ CR774194.4 Danio rerio protein_coding KNOWN, 735 bp
TAAAATGGCCAGTTCAATCTCCAAAATGGCCATGATTATT
TTATGTCTTATATGCCTTTCATAGGTCACTGTGTCCTGTT
TTTAATGTAGCGACAGTGACTTGATGTTATCTTATATTCC
AATGGCACGATTCCAGAATTTCTGCTACGTTTTGCAGGGT
CATGACACTACAGCGGCTGCTATGAACTGGGCCATACACT
TGTTAGGCTCCCATCCTGAAGTCCAGAGAAAGGCACAACA
AGAACTCTTTGAGGTTTTTGGCGAGTCTGAAAGGCCTGTT
AATACAGAGGATCTGAAGAAGCTGCGTTATCTGGAGTGTG
TGATAAAGGAGTCTCTGCGTCTCTTCCCTTCTGTTCCATT
CTTTGCCCGAACCATCTGTGATGATACGCAAATCAATGGC
TTTAAAGTTCCTAAAGGAACAAACATAGTCGTCATAACTT
ATGCCCTCCACCGTGATCCACGCTTCTTCCCTGATCCTGA
AGAGTTCCGTCCTGAGAGATTCCTGCCAGAGAACTGCGTT
GGTCGACATCCTTATGCCTACATTCCTTTCTCTGCTGGTC
TTCGCAACTGCATTGGTCAGCGGTTTGCTATCATGGAGGA
GAAGGTTATTCTGGCTTATATTCTGCGCTACTTTAACATC
GTAGCATGTCAAAAGAGGGAAGAACTTCGCCCACTGGGTG
AACTGGTATTGCGACCAGAGCAGGGCATATGGATCACACT
GGAGCGCAGAAAGCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations