Transcript

cyp4v8-201

ID
ZDB-TSCRIPT-090929-16679
Name
cyp4v8-201
Previous Names
  • cyp4v2-001
  • cyp4v8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036147 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036147|OTTDARG00000027027|ZDB-GENE-061103-601 cyp4v8|OTTDARP00000029007 cyp4v2-001 LG_ CR774194.4 Danio rerio protein_coding KNOWN, 2486 bp
TAGATTAAAACACTGGAGAGGTCACACAGACACAGACAAC
TCGCTGACAATATGGTCGCGTTTGTCGGCGTGTATACTTA
TGGGTTTGTGGCTGCATCAGTTTGTGTTATTTGCTTTGCA
TATATCACCTACCAGCTGCTGAAAAGCTATCTGCACAAAT
GGAAAGAGCTGAAGCCCATCCCGGGCATTGGAAACACATT
TCCGTTTATCGGGAACGCGCTGCAGTTTAAATCGAACGGA
GATTTCTTTCTCCAGTTGGTTGGATACACAACTGAATTCC
AGAATTCTCCACTACTCAAAATATGGATTGGACCCATTCC
ATTTCTCATCTTATTTCATGCTGAGACAGTTGAGACAGTC
CTAAATAATCCTGTTCACATTGACAAGGCCTATGCATACC
AATTTCTGCACCCCTGGCTAGGAACAGGACTACTCACAAG
TACTGGGGATAAGTGGAGACGCAGACGCAAGATGCTGACT
CCAACATTTCATTTCTCGATACTAACTGAGTTCCTGGAGG
TGATGAATGAGCAAGCAGAGGTGCTCATAGAGAAACTAGA
AAAGCAAGCCGGAAAGGGCCCATTTAACTGCTTTAGCCAC
ATCACTCTCTGTGCCCTTGACATCATCTGTGAAACTGCCA
TGGGAAAGAGGATCTATGCACAGAGCAACTATGACTCAGA
GTATGTGCGCACTGTGTACAGAATGAGTGACATCATCACC
AGGCGGCAGAGGATGCCTTGGTACTGGCCTGACTTTGTGT
ATAACTATGTTGGTGAAGGCAGAGAACATAACCGTAGTCT
GAAGATCCTCCATTCCTTCACAGAGAGTGTGATCAATGAG
AGAGCTGAGTACTTATCTTACGTTGAGTCCGACAGCGAAT
CAGATCAGGGGATGAGGAAAAGGCGGGCTTTCCTAGATAT
GCTGTTGAAAACAAAAGACGAGGATGGCAAAATGTTAACC
CATAAAGATATCCAGGAAGAAGTGGATACATTTATGTTTG
AGGGTCATGACACTACAGCGGCTGCTATGAACTGGGCCAT
ACACTTGTTAGGCTCCCATCCTGAAGTCCAGAGAAAGGCA
CAACAAGAACTCTTTGAGGTTTTTGGCGAGTCTGAAAGGC
CTGTTAATACAGAGGATCTGAAGAAGCTGCGTTATCTGGA
GTGTGTGATAAAGGAGTCTCTGCGTCTCTTCCCTTCTGTT
CCATTCTTTGCCCGAACCATCTGTGATGATACGCAAATCA
ATGGCTTTAAAGTTCCTAAAGGAACAAACATAGTCGTCAT
AACTTATGCCCTCCACCGTGATCCACGCTTCTTCCCTGAT
CCTGAAGAGTTCCGTCCTGAGAGATTCCTGCCAGAGAACT
GCGTTGGTCGACATCCTTATGCCTACATTCCTTTCTCTGC
TGGTCTTCGCAACTGCATTGGTCAGCGGTTTGCTATCATG
GAGGAGAAGGTTATTCTGGCTTATATTCTGCGCTACTTTA
ACATCGTAGCATGTCAAAAGAGGGAAGAACTTCGCCCACT
GGGTGAACTGGTATTGCGACCAGAGCAGGGCATATGGATC
ACACTGGAGCGCAGAAAGCTAACTATGTCATAAAAATATG
TCCAAATTATGTAAAATCATAAAAGGTATAAATCATAAAA
GTATGATTCGAACCATCCTGTGGAAATTATTGTTACGGGA
GTTCACTGACACAATAACAATGACTTTAGTGGATAAACTG
TTCTGTAAATGAAAACACTACTTAATTTTAACTTTTAAAA
ATATACAATTTTGTAGTTTAACAAGGTCTGCAAAAATGCA
ACTGAACAATGAGTACAATTCTTATTAATTAACAGTTAAT
TGAGTAAAAGAAGAAATAATTAGAAGAAATGAACGATTTC
ATTTATGTTAGAAGTTCTTCACTTTTTTATAGTACTTTGG
CATACTGTCTTTAGACAAACATTCAACACACATAAATTAC
TCAAACATGTACCTTATGGTGGACTGTGACCAACTTTGGA
TTGTATGTGTACTTTAACACTTATACATCATCCCAAAGGT
TACCAAATTGTAAATGAAAAGTCTATGAAGTCTGCAACAT
TATAATAAATGATGAATACAGTAATGGCTTGTGTTAAAAA
TATATTAAATGGCTAGAAACAAGACAAGTGTCAGGGAATT
AATGTCATTTGGTGCTGTCATCACTTAATAAAAAAACATT
TATATTCTAAGTTACATCAAAGTGAATCTTTCTAGAATTG
ATGGCTATTAAAAATCAGTGTGTAAATTTTGTGTATTTTC
TTTGTTGATTAAAAAATAGGGCTTTATTCCACATGCCAAT
AAAGATTAGAACCAATGAGCTTTGAGAGCAATTTTAATCT
CCCGCCTTCATAGATCATTACACTGCTCTATGCTTATACA
AACAAACTGATGTTTTTGCGTTTGTGTCAAGGTCAGGGTC
GAGCTACTGTTTGTTTGACTGAATAAAAAGTTAACTTTTT
CACACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations