Transcript

b2ml-202

ID
ZDB-TSCRIPT-090929-16660
Name
b2ml-202
Previous Names
  • b2ml-001
  • zgc:64161-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036127 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036127|OTTDARG00000027012|ZDB-GENE-040426-2136 b2ml|OTTDARP00000028989 DKEY-32E23.1-001 LG_ CR855300.21 Danio rerio protein_coding KNOWN, 3467 bp
CTCCCCCAAAAGTCCAAGTGTACAGTCGCAACCCTGGTGA
ATATGACAAAGAGAACACGCTGATCTGCTATGTCAGTGGA
TTTCACCCTCCTGACATCACCATCGAGCTCCTCAAAAATG
GACAGCCGATCGAGAAAACCACACAGACAGATCTGGCCTT
CGAACAGGGTTGGTTTTTCCACCTGACAAAGTTTGCTGCT
TTCAAGCCCCGGCCTGGAGAGGTGTACACCTGCCAAGTCC
GTCACCTCACAGAGACTAAGACCTACACATGGGAGCCTGA
CATGTGAACACACAACAATTAATGAAAACCAAAGATCAAC
ATCACTCAACAATTCTCCATAATTCTCCAAGCTGCTCCTG
CTTTAAATTCACCGTGCAATTTTTGAGTCATCCAGGCCTG
CTCCTGGAGGGCAACACTCTTGCAGATCCGGCTCCAATCT
GACTAGAAGCAGCATCCAAAAATCACGTTCATCCGTATAG
TAGGTGGAAAAGAGTATACAACAAAAGAAGAAAGAAAAAA
ATGACGACAACATGTACAACCAGATTACATTAACCCTTTC
ACACATGACACACAGGACGCAGGATGTATTTTCATGTGTT
TCTGAAGAAGATGATGAATTAGCATGTTGTAAATCCAGCA
GCTCTGATATCAGCAGCGTAGATTAAACATTGCAGCATCT
ATCACCATTCATACATCAAATAAAATGATCATTTTTAACA
TGTTCAAAACACAAAATACATGCTCTTATGCATATTTGAG
AATTGAAATATCAAATTTTGCACAATATAATTCACTTTCA
GGCATTCAAATGCACATAAATACTAGCAAAACAACATTTA
TGGTTTGTAAAATGCACACTGATGTCTATGGAGACGGCAA
TGATAATCATTTTTAAATATAACTTGACGATGTGCTTTAT
TGATGCAAGATGCACACTGTTCCTCTCCCAGTAATACTTA
GTTTTATGTATTTCGGAAGAAGATGATTAATTAACATGTT
GTAAATCCAGCAGCTCTGATATCAGCAGCATAGATTAAAC
ATGATGGCGCTCATCACCAGTCTTATATCAATTAAAATTA
TCGTTTTTAACATGTTTAAAACACAAAATACATGTTATTA
TGCATATTTGAGAATTGAAATATCAGATATTGCACAATAT
AATTCCCTTTCCACATTCAAATATACATAAATACTAGCAA
AACAACACTTATGATGTAATTGCAATTAAATATATTTGGA
CGATGTGCTTTATTGACGTAAGATGCGCACTGTTCCTCTC
CCAGTAAATCTTAGTTTCATGTATTTTAGAAGATGATGAT
GAATTAACATGTTGTAAATCCAGCAGCTCTGATATCAGCA
GTGTAGACTTAACATGATGGCGCTCATCACCAGTCTTACA
TCAAATAAATTGATCATTATTAACATGATTATAACATGAA
ATACATGTTATTATCTCTATTTGAGGATCGAAATATTATA
TATTTATTATATGTATATATTCGGACATTTATATACACAT
AAATACTACCACATAACAACTTAGTGTGCTTTATTGACGT
AAGATGCATACTGTTTCTCTCACAGTGAATCTTAGTTTCA
TGTATTTCGGAAGAAATTGATGAATTAACATGTTGTAAAT
CCAGCAGCTCTGATATCAGCATAAATTAAACATGATGGCG
TCAATTCTCGTCTAATCAAATAAAATTATACCTTCTAACA
TGTTTAAAACACGAAATACATGTTATTTTGCCTATTTGAG
GATTGAAATATTATATATTTCGCAATATAATTTGCTTTTG
GACATTTATATACACATAAATACTACCACATAGTGACCTA
GTGTGCTTTATTGACGTAAAATGCATACTGTTTCTCTCCC
AGTGAATCTCAGTTTCATGTATTTTGGAAGAAAATGATGA
ATTAACATGTTGTAAATCCAGCAGCTCTGATATCAGTTGC
GTAGATTAAACATTGCACCATCCATCACCAGTCATACATG
AAATAAAATGATCATTTTTAACATGTTCAAAACACAAAAT
ACATGTTCTTATGCTTATTTGAGAATCGAAATATCAGATA
TTTCACAATATAATTCACTTTCAGACATTCAAATACACAT
AAATACTAGCAAAACAACATTTATGGTTTGTAAAATACAA
ACTGAGGCCTATGGAGACGGCAATAATAATAGTTTTCAAA
ATATAGCTGGACAACATGCTTTATTGACATAAGAAAGCAC
GTATTGCACGATATAATTCACTTTCAGACATTCACATAAG
ATGCATACTGTTTCTCTCCCAGTGAATTTTAGTTTCATGT
ATTTCTAAAGAAAATTATGAAATAACATGTTGTAAATCCA
GCAGCTCTGATATCAGCAGCATAGACTAAACATGATAGGA
GCATACACTAAACACTTCATGCTTAAAAGACAATGTTCTC
ACGCATATTTGAGAATTAAAATATCAGATATTGCACAATA
TAATCAGGATGTTTGTCAATGTTTTCGGAAAAGGGAAAAA
AGAAAACACGATATATAAGTAAATCATTAAGACTGCCGTG
TGTAATATGATAAACTAGATAAACTAGACCTGTCGCCATG
GGAAAATTAAAGCGATGCATTTTAAATAACGGTCATGATA
AAAAAACTTGCATGTGGAAAGGGTTATTAATACTTCATAC
ATTCATGTGTTTCAAGTGGTAGCAATTTCTACTTGAGAGA
AAACGTCACAGCCGGAGCTTCTTGTTTTTCCGAAGGCTTT
GATTAGCTGGTTGAGGTGTGTTTAATCAGACATGTGGATT
GGATGTAGACTCTGTGGGACACTTTTACCCTCTAGGAGCA
GGATTGAAAGCTGCTTCACGGATTAGGACAGCAGTATCTG
CTCCTGCAAGGCCAGCGTCCTGCAGAGTTTATTTCAACAC
CAATTAAACACTCCTGAACCAACACTGGACACTTCTGGTG
TAGGACATGCTGCCTTATGTTTAGACCATAATTCGATTAC
AGTGTTTACTTACAGGATGAAGAGCAAATTACAATCTTAT
CAATATCCTTGTTAACTTCTTTAGGTGTGTATGATTTTCT
TCAGTATATCATAGGGATGGTGTTTATTACTGATATGTCA
TGATATTTGGTTTATATCATGACAGCAATTTCTAAAAGCT
TTGGGGGGTTGAATTTCTTGCCTTAGACTTCACAACATAA
GCACTTCTAGCACATTAAATCCTCTTTGTATTAAAATGTA
TCTTAAATAAAATTAATAATGTGATAAATTTGAAGTGATC
ACCTTTCATGATGACTCTTGTTTAATTTGTTTGTAATGTT
TCAGTAGCCTGAATGTTCGAGCAGGCACTGATATTTTGTT
TTAAATAACTCCACATTTTAAAAAGCTAATTTCTGTCTAT
GGTGTGTTATCATCACTGACTGTATAATGTTTTGTAATTC
ATTTAAATAAACCTTTTCCATCTTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations