header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16308
Transcript Name: wnt2bb-201
Previous Name: wnt2bb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000035720 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000035720|OTTDARG00000026795|ZDB-GENE-060824-6 wnt2bb|OTTDARP00000028683 wnt2bb-001 LG_ BX664731.12 Danio rerio protein_coding KNOWN, 1413 bp
CTTGGATTATTTCTGCTGCGGTTGCCAGATCTCGGGGAAT
ACTTTTATATGGCACACGCTAATTCCCGGGCAGATACATG
ATATCCGTCCGTGCATCGATCGCACGGAGCGCTGAATCTA
AAGCCCAAACTTCAGCAGGTCCCCGCAGACCTAAAGGTCT
ACACCGGTTTCCGACACCACACAATCGTGTTTTCTTATCA
CCGCTGGAGGACACGCTCAACAATGTTCGGCTGCGGTGAA
GTTCTTGGGTCGCCCCGAATTCTCGTCAGGTCGAGCGCTG
CTCCCGGAGGCACAGGATTAAGACATATAATCAGAAACAG
CTCAGGCTCATCGTACGGTCCCCGTGCGTCCTCGCGATTG
TGTTGCGCGCTCCTGTTCCTTCTTCTCATCCTCACACCGC
GCGTGGACTCGTCCTGGTGGTATATTGGAGCCCTTGGTGC
ACGTGTGATCTGTGACAATATTCCTGGGCTGGTGAATAAA
CAGAGACAGTTGTGTCAGAAATATCCTGACATCATGCAAT
CGATAGGTGGTGGCGCTAAGGAGTGGATTCGAGAGTGCCA
GTATCAGTTTCGTCATCACCGCTGGAATTGCAGTGCCCTG
GACAGAGACCATACTGTTTTTGGGAGAGTAATACAGCGCA
GTAGTCGTGAGGCAGCGTTCGTATACGCGATCTCCTCGGC
TGGTGTGGTTTTCGCTATTACCCGCGCTTGCAGTCAAGGG
GAGTTGAAGGCGTGCAACTGTGACCCACAGAAACGTGGAC
GAGCCAGTGACGAACGAGGAGAGTTTGACTGGGGAGGCTG
TAGTGACAACATCAACTATGGGATAAAGTTCGCCAAAGCC
TTCATAGATGCCAAAGAGCGAACTGTGAAAGACGCACGAG
CGCTCATGAACCTTCATAACAACCGCTGTGGAAGAATGGC
TGTAAAGCGCTTTATGAAACTGGAGTGTAAATGTCATGGA
GTCAGTGGCTCGTGCACCCTCAGAACCTGCTGGTTGGCAA
TGTCAGATTTACGTAAAACAGGAGATTACCTTCGCAAGAA
GTACAACGGAGCCATCGAGGTCACCATGAACCAAGACGGG
ACAGGATTTACAGTAGCCAATAAAGACTTTAGAAAAGCCA
CAAAAAATGACCTGGTGTATTTCGAAAACTCACCTGATTA
CTGCCTCATGGATAAAACTGCAGGTTCATTGGGCACTGCT
GGTCGGGTCTGTAACAAGACATCCCGAGGGACAGACGGCT
GTGAAGTTATGTGTTGTGGGCGGGGCTACGACACCACACG
CTCAAAACGCATCACCAAGTGCGAATGCAAGTTTAAGTGG
TGTTGCACTGTAGAGTGCAAAGACTGCGAGGAGGCTGTCG
ACATTCACACCTGCAAAGCTCCGAAACGTGCGGAATGGCT
GGACCAGACCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
wnt2bb-201 Contained in:
[BAC] DKEY-67N5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000035720 (1),  Ensembl_Trans:ENSDART00000046004 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DQ231559 (1) 1413 bp
CITATIONS (2)