Transcript

fabp3-202

ID
ZDB-TSCRIPT-090929-16162
Name
fabp3-202
Previous Names
  • fabp3-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035549 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035549|OTTDARG00000026695|ZDB-GENE-020318-2 fabp3|OTTDARP00000042556 fabp3-002 LG_ CU207343.7 Danio rerio protein_coding KNOWN, 569 bp
CGTCTCCTGCTCTAAAGTCAGCTGTTTACAATTAGCGTCG
ATCTACCACGAATCGTGTTGGCTTTGCCACGCGCCAAGTT
GCCAATATGACCAAACCCACAACCATCATCTCCAAGGAGG
GCGACGTTTTCACACTTAAAACCGTCAGCACTTTCAAATC
CACAGAAATCAATTTCAAACTGGGAGAGGAGTTCGATGAG
ACCACTGCAGATGACCGAAAAGTCAAGTCTGTTATAACTT
TAGATGGAGGGAAGTTGTTGCATGTTCAGAAATGGGACGG
TAAAGAGACGACCCTGCTGCGAGAAGTCAGTGACAATAAC
CTCACTCTGACGTTGACACTTGGCGACATCGTCTCCACAC
GACACTACGTGAAAGCAGAATAAAGGGAAAGCTGAGCCTC
AATCCGTCCTCATCAATGGTTATGTACATGTTTTTCTGTG
GTGTTCATGCTCTCCTTTGCACCGTTTCCCCAACACTGAA
TAAATTCCAACTTCCAAACCTCCAGATTTCTGTATATGAT
CTTGTATTTCTGGGTGTATGATATGCCCGGCGGTCAGTGT
TATTATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations