Transcript

fabp3-201

ID
ZDB-TSCRIPT-090929-16161
Name
fabp3-201
Previous Names
  • fabp3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035548 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035548|OTTDARG00000026695|ZDB-GENE-020318-2 fabp3|OTTDARP00000028564 fabp3-001 LG_ CU207343.7 Danio rerio protein_coding KNOWN, 781 bp
ATCAGCCAGTAGGATCGCAGCAGAAGCTCTGTGGTGGTGC
TGTCTTACCTCTCTCTCTCTCTTTCTCTTGCGTCCCTCCA
TCTGCTCTCGCTCTCATTCTCTGCTGCGCTTCAGCTCAAA
CATGGCAGACGCTTTTATCGGCACGTGGAACTTGAAGGAG
AGCAAGAATTTCGATGAGTACATGAAAGGAATTGGTGTTG
GCTTTGCCACGCGCCAAGTTGCCAATATGACCAAACCCAC
AACCATCATCTCCAAGGAGGGCGACGTTTTCACACTTAAA
ACCGTCAGCACTTTCAAATCCACAGAAATCAATTTCAAAC
TGGGAGAGGAGTTCGATGAGACCACTGCAGATGACCGAAA
AGTCAAGTCTGTTATAACTTTAGATGGAGGGAAGTTGTTG
CATGTTCAGAAATGGGACGGTAAAGAGACGACCCTGCTGC
GAGAAGTCAGTGACAATAACCTCACTCTGACGTTGACACT
TGGCGACATCGTCTCCACACGACACTACGTGAAAGCAGAA
TAAAGGGAAAGCTGAGCCTCAATCCGTCCTCATCAATGGT
TATGTACATGTTTTTCTGTGGTGTTCATGCTCTCCTTTGC
ACCGTTTCCCCAACACTGAATAAATTCCAACTTCCAAACC
TCCAGATTTCTGTATATGATCTTGTATTTCTGGGTGTATG
ATATGCCCGGCGGTCAGTGTTATTATAAATATGCATTTGG
TCTACAATAAAGATGACTTTTGCTCCAAATTCACCTTGTG
CAATTTATTGTGTCAATATTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations