Transcript

slc5a9-202

ID
ZDB-TSCRIPT-090929-16124
Name
slc5a9-202
Previous Names
  • slc5a9-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035507 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035507|OTTDARG00000026669|ZDB-GENE-080513-3 slc5a9|OTTDARP00000028537 slc5a-002 LG_ BX005425.12 Danio rerio protein_coding KNOWN, 522 bp
CGAGGAGGTGCCAGCCAAGTTTACTTTGGAGGCTGCTGAT
ATCGCAGTGGTTGTGGTTTACTTTGTGTTTGTATTGGCAG
TTGGAATATGGTCTTCCATCAGAGCCAACCGTGGAACAGT
GGGTGGATATTTCTTGGCAGGACGATCCATGACCTGGTGG
CCAATTGGAGCCTCTCTGATGTCCAGTAACGTCGGCAGTG
GCTTGTTCATCGGATTAGCTGGGACAGGAGCCGCTGGGGG
ACTCGCCGTCGGGGGATTTGAGTGGAATCGTGGGTCCTCA
TCGCCCTGGGCTGGATTTTTGTGCCCGTATATATTTCTGC
TGGAGTGGTCACCATGCCGGAGTATCTGAGGAAGAGGTTT
GGGGGTCAGCGAATCCGGATCTACATGAGTGTGCTGTCTC
TCATCCTCTACATTTTAACCAAGATATCAGTAAGATCTTT
GGGTGGACTGACAGCAGTGATCTACACTGACGCCTTGCAG
ACCGTCATCATGGTAATAGGAGCATTTGTCCTCATGTTCA
TA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations