Transcript

slc5a9-201

ID
ZDB-TSCRIPT-090929-16123
Name
slc5a9-201
Previous Names
  • slc5a9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035506 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035506|OTTDARG00000026669|ZDB-GENE-080513-3 slc5a9|OTTDARP00000028536 slc5a-001 LG_ BX005425.12 Danio rerio protein_coding KNOWN, 2188 bp
ATGCCAGCTTCACCTGAGCCTGTGACGGCCACTCCAGAGC
CCGAGGAGGTGCCAGCCAAGTTTACTTTGGAGGCTGCTGA
TATCGCAGTGGTTGTGGTTTACTTTGTGTTTGTATTGGCA
GTTGGAATATGGTCTTCCATCAGAGCCAACCGTGGAACAG
TGGGTGGATATTTCTTGGCAGGACGATCCATGACCTGGTG
GCCAATTGGAGCCTCTCTGATGTCCAGTAACGTCGGCAGT
GGCTTGTTCATCGGATTAGCTGGGACAGGAGCCGCTGGGG
GACTCGCCGTCGGGGGATTTGAGTGGAATGCAGCGTGGGT
CCTCATCGCCCTGGGCTGGATTTTTGTGCCCGTATATATT
TCTGCTGGAGTGGTCACCATGCCGGAGTATCTGAGGAAGA
GGTTTGGGGGTCAGCGAATCCGGATCTACATGAGTGTGCT
GTCTCTCATCCTCTACATTTTAACCAAGATATCAACAGAC
ATTTTTTCAGGGGCTTTATTCATTCAGGTGTCACTGGGGT
GGGATCTTTATCTCTCCACTGTTATTCTGCTGGCCGTCAC
TGCACTCTATACTATAGCTGGTGGACTGACAGCAGTGATC
TACACTGACGCCTTGCAGACCGTCATCATGGTAATAGGAG
CATTTGTCCTCATGTTCATAGCATTTGACAAGGTTGGATG
GTACGAGGGTTTGCTGGTTCAGTATGAGAAAGCTGCACCT
GCTCTCACAGTTCCCAACACCACTTGTCATCTTCCTCGCT
CTGATGCCTTTCATATCTTCAGAGACCCAGTGACGGGAGA
TATTCCCTGGCCCGGCCTGATCTTCGGCCTTACCGTTCTG
GCCACATGGGTCTGGTGCACAGACCAGGTGATAGTGCAAA
GGTCTCTGTCGGCAAAAAACCTGTCTCATGCCAAAGCTGG
TTCAGTGCTCGGTGGCTACCTCAAGGTCTTCCCTATGTTC
TTCGTAGTCATGCCAGGAATGATCAGCAGAGCTCTCTATC
CTGATGAAGTAGCATGTGTTGATCCCGATGAGTGTCAGAA
GATCTGTGGGGCCAAGGTCGGCTGCTCGAACATTGCCTAC
CCAAAATTAGTGGTGGAGCTCATGCCAGTGGGTATGAGAG
GGCTGATGATCGCTGTAATGATGGCAGCACTCATGTCCTC
TCTCACCTCTATATTCAACAGCAGCAGCACCTTATTCACT
ATGGACATCTGGCAGCGGATCCGGCCCCGGGCCTCTGAGA
AAGAGCTCATGGTAGTGGGCAGAGTGTTTATTTTATTGCT
AGTGGCCTTGAGCATTGTGTGGATTCCAGTCATTCAAACG
GCTAATAGTGGACAGCTGTTTGACTACATTCAGGCTATAA
CTAGCTTCCTGTCACCTCCCATCACCACAGTGTTCATTAT
GGCCATATTTTGGGGGAGAGTAAATGAACAGGGAGCTTTT
TGGGGTCTGATGGTGGGACTAGTGGTGGGCATGGTGAGGA
TGATAATGGAATTTGTCTATGGCACACCATCATGTGGAGA
GACAGACCTGCGTCCCAGCCTGCTGAAGGATGTGCACTAC
CTGTATTTTGCGCTTATTCTGCTCGCCCTGACAGTTCTGA
TCATCACAGCCGTCAGCCTCTGCACTGCACCTATTCCAGA
AAAACACCTTGTTCGTTTGACCTGGTGGACAAGACACAGT
AAGGAGGAGCGTGTAGAGCTGGAAGACCCCTGGGCCAAAC
CAGCAGGCTCTGATCTCAGCACAACGGAGTCAGAGGGGTC
GGATGAGGACGCGCCTGCATGGTGGAAACGTGCTGGAATG
TGGCTGTGTGGACTCTCCCAAACGACTAAACAAGACCTGA
CTGAGGAGGAACGGCAGGCACTGGAAAAGAAACTCACTAG
TATTGAAGAAGACCACATGTGGAAGACTGTGTGCAACGTC
AATGCCCTCATTTTGCTCACTGCCAATGTGTTTCTTTGGG
GGTACTTTGCTTGAATGTACTGTAAAGTTCTATAATGGCT
AATTGTTTTGTTAGAAACTAATAGTTTAAGTGTTGACGTT
GGCACTTTGAACACTCATTTTTATTTAAAATGTTTTGAAT
AACATTTTATTTGAAGTTTGTTGCAAACAATATTAAATAA
TTACTGCTGTGCCATAATGACAAAGCCATGAATGAATGCA
TAAATAAATAAATAATAAATATATAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations