Transcript

adamts10-201

ID
ZDB-TSCRIPT-090929-15970
Name
adamts10-201
Previous Names
  • adamts10-001
  • si:dkey-45m5.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035320 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035320|OTTDARG00000026555|ZDB-GENE-081104-414 adamts10|OTTDARP00000028393 DKEY-45M5.4-001 LG_ BX511253.13 Danio rerio protein_coding NOVEL, 3978 bp
ATTTATGTTCTCCATTTGTACACGTCTCAGAACAGCCCGT
CCTCCACCTCTGACTCTTGAGAGACGAAGCGTCAGGATCC
AGTGGAATTGAAGCTGCCATGGTTCTGGAAATCTGTGCGT
CACTTTGGTGAGCGTTGGGCCGTCAGAGGGCAGAAGACAT
GTTGGGACAGAGGGCTGGGCACCCCATTGAAGCTTGCTGT
AGTAACCATGGAAACGGTGTGGAGGAGTTTGGCCTGTGTT
GGCATCATGGCCATGGTTGCCAGTGGAGGGGCGGAGAGTT
GGAGCGATGAGAAGTTTGCACAGTCTCAAGCTGAGTTTCT
GTCCAGCTTGGGCCAGTATGAGATTGCCATCCCAGTGCGT
GTGGGGCCTCATGGGGAAACTCTTTCGGAAGAGGAGACGT
CTCACGGGACTGTCCGCCACCGGCGCAGCACCGAAACACA
GAGCGCTCCAGAGCCGCAGCTGTACTATCAGCTCTCCACT
TCCAGCACTGATCTGCTGCTCAACCTCACGCTGCAGGGAG
GACTGCTCTCGCGCCAGTTTCGTGTCGAATACTGGAAGAG
GGGCCGCTTGGCCTGGAGCCACCCATACTTGCCCAGCTGC
CACTATGTGGGTCACCTGCAGCACCAGCCGCACTCCAGTT
CTGTTGCTCTCAGCAACTGTAACGGACTGCAAGGGGTCAT
TGTAGCAGGAGGTGAGGAGTACCTTATTGAACCCCTGGTT
TCTGCTAAAAACTTGACTAATGAGGATGGCAGAGAAGGGC
GACCACATGTTGTGTACAAACGCTCGTCTCTGAGATATCA
GAACATGGACCAGTCCTGTGGAGTTATCGATGAGAAGCCT
GGGAAGAGTTATGGATGGTGGCAGAGAACAATAAAACCCT
CACCCAACCAGATGGGACGGGGCCAGTTGCCACTGAAACG
TTCTGTAAGTCGAGAGCGCTTCGTCGAAACCCTGGTGGTT
GCCGACAAGATGATGGTCAGCTATCACGGCCGTCGCGATA
TCGAGCAGTACATTCTGGCCGTCATGAATATTGTTGCCAA
ACTGTTCCAGGATTCTAGCCTGGGGAATGCAGTGAACATC
GTGGTGACGAGGCTTATTCTGCTGATGGAAGACCAGCCCA
CGCTAGAGGTAAACCATCATGCAGGGAAGTCTTTAGACAG
CTTCTGCAAGTGGCAAAAGTCTATCTTGCACCGGAACGGT
CATGGAAATGCCATACCTGACAATGGAATCGCTCACCATG
ATACAGCAGTTCTCATCACCAGATATGACATCTGCATCTA
CAAGAACAAACCCTGTGGAACTCTTGGTCTGGCACCTGTT
GGAGGTATGTGTGAGCCAGAGAGAAGCTGCAGCATCAATG
AAGACATTGGCCTCGCCACTGCTTTTACCATTGCACATGA
GATTGGACACACGTTTGGGATGAATCATGATGGTGTTGGC
AATGCATGCGGGGTGCGCAGTCAGGAGACCGCCAAACTCA
TGGCTGCCCACATTACCATGAAGACCAACCCGTTCGTCTG
GTCCGCCTGCAGCCGCGATTACATCACCAACTTCCTCGAC
TCTGGCATGGGTTCCTGCCTCAATAATGTGCCCCCCAAGC
AGGAGTTTGTGTACCCCACCACAGCCCCAGGCCAAGCTTA
TGATGCAGACGAGCAGTGCCGCTTCCAGTACGGAGTGAAG
TCTCGTCAGTGTAAATACGGGGAAGTGTGCAGTGAGCTCT
GGTGCATGAGTAAAGGCAATCGCTGCATCACCAGTAGCAT
CCCAGCAGCTGAGGGCACCATTTGCCAGACCAGCACTATC
GAAAAAGGGTGGTGCTACAAGAGATTGTGTGTGCCGTATG
GAACACGGCCCGAGGGTGTGGATGGTGGGTGGGGCCACTG
GTCTCCATGGGAGGAGTGTAGTCGCACATGTGGGGGCGGA
GTCTCATCCTCCATTCGTCATTGTGACAGCCCCAGGCCAA
CGGTTGGAGGGAAATATTGTCTTGGAGAGAGGAAGCGCTT
CAGATCCTGCAACATTGATGAGTGTCCAGTCGGGTCTCAG
GATTTTCGGGAGATTCAGTGCTCAGACTTTGACAGCGTTC
CTTTCCGGGGAAAATTCTACACCTGGAAGCCATACAGGGG
AGGTGGAGTGAAGTCATGCTCACTGAACTGCCTGGCCGAG
GGCTATAACTTCTACACTGAGCGCGCTCCAGCTGTAGTGG
ACGGCACACCCTGCAGAGATGACTCTCTGGACGTTTGTGT
TAATGGGGAGTGTAAGCATGTGGGCTGTGACCGGATCCTG
GGCTCAGATGTGCGGGAAGATCGCTGCCGTGTTTGTGGAG
GAGATGGAAGCAGCTGCCAGGTCATCGAGGGGGTCTTCAA
TGACTCCTTGTCTGAAGGAGGTTATGAAGAGGTGGTCAGA
ATCCCCAAAGGATCTGTATTCATACACATCCAAGAGCTCA
ACATCTCTCTGAATTACTTGGTGTTGAAGAGCAAAGGGGA
TCAGTACTTCATCAATGGCAAGCTGACCATCGATACACCG
CGCCGCTTCGACATTGCCGGTGGTACCTTCCACTACCGGC
GACCCGCCAATGAACCAGAGACCCTGGAAGCTCTCGGACC
TACCAACATGACCCTGATCGTGATGGTCTTGGTCCGTGAA
GAGAATCCAGGAATTCTATATCGATTCAACCCTCCAGTCA
GCAGAGATCCTCTGAGCAGTTACTCTTGGCATTATACATC
CTGGTCCCGCTGCTCTGCACTGTGTGCTGGAGGGGTTCAA
GTCCAGCAGGTAGTGTGCAAAAAACAAGCTGATCTCTCTG
TGGTCTACAATCACTTCTGCGACAAGAAGAACAAGCCCAA
AGACAAGAAAAGACCATGCAACCAGGAGCCTTGTCCTCCA
ACGTGGTGGACAGGAGACTGGTCAGAATGCAGTCGGAGCT
GTAATGGAGGAGTTCGCACGCGGGAAGTGCTGTGTAAGAG
GAAGATGTCTGTAACAGAAGAGAAAGTGCTGGACGACACA
GCCTGCACCACAACACGGCCTTCCGTCACAGAGCCCTGCA
ACAACCACACCTGCCCACCCGAGTGGCACGCGCTCGACTG
GTCAGAGTGTACTCCTGGCTGTGGTCCGGGATACAGGTAC
AGGGTGATTTTATGTAGAAGTGGAGACAACGGAGAGACGC
TGCCAGAGTCTGAGTGCCCGAAACAAAGCCGCCCGACCAC
CAGAGTGCGCTGTAACATACAGCGGTGCCCACCACCTCAG
TGGGTCGCAGGTCCCTGGGGAGAGTGTTCTGCGAGGTGTG
GAATGGGTCAGGAGATTCGTTTTGTTCAATGTCTGACACA
CACTGGCCAGCCGTCCAATGAGTGCCCTGAGTCTCATCGT
CCAGCCTTCATGCAGCAGTGCAAGAGCAAGTGCGACCACA
GCGGCCCTACAGACAACCCTGAAGAGTGTAAAGATGTGAA
CACAGTGGCGTACTGCCCCCTGGTGCTCAGGTTCAAATTC
TGCGGCCGTGCATATTTCAGACAGATGTGCTGCAAAACCT
GCCAAGGACACTGACCTCTCTCTCTCTCCTCCATACTCAA
ACACATGCACACAGTTATTTTTCTATGTCTCTCTCTCTCT
CACCCTGGTTTTCTTCCTCTCCGCCCTCCCATCTTCTTGC
ATGGCCAAAACCGCCCATGCTCAGCATTCCACTGGAGGAG
CGCAGTCAACCACTTGCAGGCTGACATCACTGAGGGAGAA
AGCATGGGGGAAAGAAGAGAAAGAGAGAGAAATGCGGAAA
GAACGAGAGAGAATGTTTCTCTCCCTCCGACCAGCTGCTT
TGGCACTGCTGCTGTGAAAACCAGTCTGTCCAAAAGACCT
CTGTCAGTCTTCGTAAGCTCTTCCGCATGGTGCTCTGGGT
CGTCACTTGTCAAGCAGAGAAGTGTTTGTGTGAGCTGTCA
CACCTGTAGTTCTCAGTGAGTAATAGTCATCTAATGTGAT
AAAAGATTCATTTACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations