Transcript

jak3-201

ID
ZDB-TSCRIPT-090929-15648
Name
jak3-201
Previous Names
  • jak3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034958 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034958|OTTDARG00000026359|ZDB-GENE-070725-4 jak3|OTTDARP00000028135 jak3-001 LG_ CR936448.18 Danio rerio protein_coding KNOWN, 3410 bp
ATGAGTGAAGAGGAAGAGGTGCCGTTGATGAAGAGTGAAC
GGGCCGGCAGTCAGCGGTCCAGCTGTGACTCAGCCCTGCA
GGTGCATCTGTACTACAGTCCCAGTTTAAACTCAGAGACC
ACCTTCAGCATACCCACCGGACATGTGACAGCTGAGAGCG
TGTGTGTGCTCGCTGCTAAAGCCAGTGGAATTCTTCCTGT
GTATCACAACCTCTTTGCTTTGGCATCAGAGGATCTTTCA
TACTGGTATCCACCAAATCATCTGTTTAAGAGTGAGGAGC
CCGTCAAAGTTTACTATAGAGTGAGGTTTTTCTTCTCAAG
CTGGTTTGGTCAAGAGTCGAGAGCATCGTACCGCTTTAGC
CTCAGCAAGGGACGAATCTTTGCTGTGCTGGACTATGCTG
TCATTGACTATGTTTTTGCTCAATCCCGCAGTGATTTTGT
GACTGGATGTGGTGGGATTTCTCCTGCATTGAGTTTGCAG
CAGGAATGTTTAGGTTTGGCAGTGCTGGATCTGTGGCGTT
TGGCCAAAGAGAGAAACCAGAGCCTTGCAGAGATCTGCAA
TACAACAAGCTACAAGTCCTGCCTCCCGGAGACTCACCGA
CAGGACATCCAGCGCATGAACCGCCTGGCGCGATATCAGA
TCCGCAAAACACTGAAGCGCTTCCTGAAGAAGCTGGGCAA
GTGCTCGGCTGGAGAGCGAAGCCTGAAGCTCAAGTACCTG
ATGAAGCTGAGTGAGCTGGAGCCGGATTATGGTTCAGAGA
GCTTCCCCCTCCACCACTCCGGGTGGTTGGAACAGAGCGA
GCAGCAGAGAGTTCTAGCCGTCAAAGTGTCCGGAGAGGGA
GGCATTCAGATACAGAAAACAGACAGACAGGAATGGCAGA
CATTCTGTGACTTCCCCCAGATCATTGACATTAGCATTAA
GCGTCTCTGTCAAGAGCAGATGCCTCTGGAAGGAAGGGTG
GTCACACTCACGCGCCAGGATGACCAGTGCATGGAAGCTG
AGTTTCAAACCCTGACAGACGCCCTTTCCTTTGTATCTCT
GGTTGATGGATATTTTAGACTGACCACAGATTCAACTCAC
TATTTCTGCGCAGAAGTGGCCCCACCAAGCCTGCTGGAGG
ACATACAGAATTACTGCCACGGCCCGATCACGTCAGAATT
TGCGGTGCACAAGCTTAAGAAAGCTGGAGGCAAGAATGGG
ATGTTTCTTTTACGCCACAGTCCCAAGGAATTTGACAAGT
ACTTCCTCACAGTTTGTATACAGACTCCTTTGGGGATGGA
TTACAAGGACTGCCTGATAGAGAAAAATGAGAAGTTCAGT
CTGGCTGGGATCCACAACTCATTCATCAATCTGAAACAGC
TCATCGACTTCTATCAGCTCAGTACGCTATACGTTTCAGA
CATCCCTGTCACCCTGGGCAAGTGCTGCCCACCCAGAGCA
AAAGAGCTCACAAACATGATCATCATCCGTAACAGCAGTA
TGACTGAGATACCCAGTTCCCCCACCTTACAGAGACACAA
ACCAAGCCACATGCAGTTCCACATGATTAAACATGAGGAC
CTCATCTGGAGTGAAAGTTTAGGTCAAGGTTCCTTCACGC
ACATCTTTAGAGGTAGTAAAATAGACCAGAGGGATGGAGG
AACACACTCCACCGAGGTCCTTCTGAAAGTCCTGGATGCA
AATCATAAAAACTGCTGGGAGTCTCTTTTCGAGGCGGCCA
GTTTGATGAGTCAAATCTCCCACAGGCACCTTCTTTTGGT
GTATGGCATTAGTGTGCACAAATCCAAAAACATCATGGTG
CAGGAGTTTGTGAAGCACGGCGCACTGGACCTGTACCTGA
AGAGGAGCATGTGTGTCTCAGTCAGCTGGAAACTAGATGT
GGCCAAACAACTGGCCTGTGCTCTTAACTTCCTGGAGGAG
AAGAATATTGCACATGGGAATATTTGTGCAAAGAATCTGC
TGTTGGTCCGAGAGGGCGACTCACCCTTCATTAAACTGAG
TGACCCTGGCGTCAGCATGTCCTTGCTGGGCAAAGATGTG
GTGTTGGACCGAATCCCATGGGTGGCCCCAGAAGTTCTGG
ATACACTTGAGATTGAACTGGAGTGTGACAAGTGGAGCTT
TGGGACAACGCTGTGGGAGATTTTCAATGGTGGAGAAGCT
CCATTACAGGGCCTGGACCTCATGCAGAAGCTGCAGTTTT
ATGAGAACTTCTCGAACCTTCCAACGCTGGAGTGGACTGA
ACTGGCTGAGCTGATCTCTCACTGTATGCAGTACCAGCCT
GAGCTCAGACCGTCCTGCAGGAGCATCATCCGACAGCTGA
ACAGCCTCATCACTTCAGATTATGAGATTCTTCATGCGAC
TGACACACTGCCTGAAAGCAATGGCTTCTGGAAGAAACTG
AACATATTCAAAAAGCAACAGGAGGATGTTTTTGAGGAGA
GATACCTGCGATTCATCTCTGTTCTGGGAAAGGGTAACTT
TGGCAGTGTTGAGCTTTGCCGTTATGATCCATGGGGTGAT
AACACTGGAGAACTGGTGGCTGTGAAGGAACTTCAGTCTA
ACAAGCAAGCCACAATGGCAGATTTCCAGAGAGAAATCCA
GACCATCAGCTCCCTGCACTGTGACTACATTGTCAAATAC
AAGGGCATCTGCTACAGCACAGGTCGGCTGAGCACAAAAC
TGGTGATGGAGTATCTTCCATACGGCAGTCTCATTGGTTA
TATGGAGAAACACAGACACAATGTGGGCAATCGCAAACTA
TTGCTATTTGCCTCGCAGATATGTAAGGGAATGGAGTACC
TGCAAAGCATGCGTTACGTTCACCGTGATCTAGCTGCTCG
CAATATTCTAGTCGCCAGCGACAATCTGGTCAAAATTGCA
GATTTCGGACTGACCAAGATCATCCCGGTGGATAAAGAGT
ACTACCGTGTCACACAGCCAGGAGAAAGTCCTGTTTTCTG
GTATGCACCTGAATCCATCTCAGAACTGAAATTCTCCCAC
AAGTCAGATGTGTGGAGTTTTGGCATTGTTTTACATGAGC
TCTTTTCTTACTGCGACATCAGTCAAAACCCCAAAAAGTT
GTGCATCCAGAAGATTGGCAGATATGTCCATAGTCCATCC
ATGGCCATCCATCTCCTCACTCTTCTCAAGAATAACTGGA
GATTACCAGCTCCAGCTCAGTGTCCACTAAAGGTGCACAG
TATTATGATGCAGTGCTGGGAATTCAACAGTGAGAACAGG
CCGAGCTTCTCCTCTTTAAAGGATCTGATTGAGAATAGCC
TGTTAGATGAAAGAGAGGGATGTAAAGGGTAAACTCAGAG
TTAACTTCAGCAGATCAGTTAATTTCATATATATATATAT
ATATATATATATATATATATATATATATATATATATATAT
ATATATATAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations