ZFIN ID: ZDB-TSCRIPT-090929-15552
Transcript Name: si:ch211-204d2.4-201
Previous Name: si:ch211-204d2.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034854 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034854|OTTDARG00000026293|ZDB-GENE-081105-163 si:ch211-204d2.4|OTTDARP00000028056 CH211-204D2.4-001 LG_ CR847826.13 Danio rerio protein_coding NOVEL, 1340 bp
GGAAAAGGGCAGCGCACGAAACACAGAGCTCAGCTTTCCG
CTCGGAGCTTTCATCCGTTTTGCCAGATAAATGAGCGCGC
ATTGAGTCTCTACAGTATATTGTTATGAGAGCGCGCTGAA
CGACACGCACACGGCGGACCGCGGATCTGGGACAGGACAT
GCCTTACCTGGACAGACAAAATCGGACCTGTGGATTTCTG
GATATTGAGGAAAATGAGAACAGCGACAGGTTTTCCCGCC
GTTATTTTATCTTGGACACCGATAAGAATTATCTCCTCTG
GTACATGGACAATCCTCAGAACCTACCTGTTGGAACGGAG
CATGTTGGAAGTTTACGACTCAGTTACATTTCAAAGGTTA
ATGAAGCATCACTGAAGCAGAAACCAAAGGCTGAGTTCTG
CTTTGTAATACATGCGTTATCCAGGCGGTACTTTCTGCAG
GCGAACGATGCTTTGGACTTGAAGGAGTGGGTCATTGCTG
TAAACAATGCCACAAAAATTACGGTTCCAAAAGCATCGCC
GGTGTGTCAAAGCTCTGATGTCACAAATGTGTCAAACCCA
AGTCAGTCGGCTCCTCGACAGGCCTACACCACTGCGATTG
TCGGCGGTGTGGTTGTGCAAACACCAGTCCAGCAGAACGA
CTCTGAAGATGTCTTCATGGCTGATCCAGGGGCTCACGTC
CCTTTGAGAAGATGCCAGAGTGCACGTCCAAATGCCTTGA
GGTCTGGCTACTGTGTCAAGCAAGGCAATGTGAGGAAAAG
CTGGAAGAGGAGATTTTTTATTTTGGATGACCAAACTGTG
AGCTACTACAAATCTGAAATGGACAAGGAACCGTTGCGCA
GTATTCGATTGCGGGATGTGCTGAAAGTGAATGAATGTCT
TGTGAAATCAGGGGATCTACTGTCTCGCGATAATCTTTTT
GAAATCATCACCAGTGCCAGAACCTTCTACATCCAGACAG
ACACCCCAGAAGACATGAAGGGCTGGATCATGGACATTGC
TTCAAAAATTCAAGACTTTAGAGGACCGTCTAAGCCCCGC
TCGTCCATGAAAGTGTTTTCTTCGCAGAGGAAGCCTCAGC
TTATCAAGTCCTGCTCCACAGCAGATTCATGGCAGCCGTG
GACTCCGGTGCCCAGTCAGGACAAGCACTTGAAGGAAGAA
GGTCAAAGAGAGGGGCCGTACAGCTCTCTCCCCTCCCTCT
CACTCGCCAGCCACATCATTCAGTCTCAACAAAGTCATCA
AAGCCGACAACGGCACCATTCCCAGCCTCAGCCTGCTCCC
AGCAGCACAGACTTTCCTGAAAACCTTGACAGCCTCCGCA
CCACTGATGTTTAGTTGATT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-204d2.4-201 Contained in:
[BAC] CH211-204D2 (1)

Genome Resources: Vega_Trans:OTTDART00000034854 (1),  Ensembl_Trans:ENSDART00000133532 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB934713 (1) 605 nt
GenBank:EB987919 (1) 587 nt
GenBank:AL914891 (1) 534 nt
GenBank:EB928586 (1) 458 nt
CITATIONS (2)