ZFIN ID: ZDB-TSCRIPT-090929-15283
Transcript Name: lats2-204
Previous Names: lats2-001, si:ch211-173o4.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034493 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034493|OTTDARG00000026065|ZDB-GENE-050119-6 lats2|OTTDARP00000027803 CH211-173O4.2-001 LG_none BX511129.15,BX936339.11 Danio rerio protein_coding NOVEL, 3922 bp
GTACTGCATTCTAATTCCGCCGTGAGTGGCGAGAAAATGG
AGGACAATCCCATGATTTTTACTCCGTGCTTTTTATGAGA
GGACGAAGAAAGGCCAACAAATCTTTAGACAGATAGTCCG
CAACTTTACTGAAGTTTAAATCAGTTCCTTGGATTAAGGC
ACCGCTTATTTCACATGGGCAAACATGCATACCAGACTGG
GATGGAAGAAGCATGCAGACGTAAACCCTCACATGTCTTT
GGAGGAGGGGGAGTGTGAGCCTTGAAAGGGTTGCTGGGAT
GTGAGTAGACCTGCATCCAGCGCACACCAGAGCCAAAGAG
GCAGCAGCTACAAAGACTAGCGACAACAGCAGTGCTAATC
TCCACTCACATCTTTCTCACTGCAGCCTGTGTTATCTATT
CAGTGTGAAGAGTTTGTGTGAGAGAAAACAGGCCAAGTTC
ACTCATGAGGCCGAAGACGTTCCCTGCCACTCCATATGTG
GGCAACACACGCCAGCGCCTGCAGGACATCAAGGAGGGTC
TGAAACAGCCAGCGAAGCTGGTGAGTCAGGCACTTCATGG
AGGCAGCTCTCGAGGAGAGGGTGGTCGAGGTGGAGACTCA
AAGGGCAAAGACCAGGCTGCCAGACAACAGCAGCTCCGGC
CGCCCCAGAAGTTTAACAACTACCAGAGTGCCCTCCGAGA
GATCCGCAAGTCTCTGAGGCCCTATGCCAATGATTCAGGT
CCAGGATCCAGCTCCGGGCATCCCGGTGAGGTCAGCAGAC
AGATGCTACAGGATCTGGTCAATGCCGGTTGCGATCAGGA
AATGGCAGTGCGTGCCCTGAAACAGACTGGTAGCCGTAAC
ATCGAGGCAGCATTGGAATACATTAGCAAAATGAGTTACC
TTGATCCTCACACTGAACAGATTGTACGTGTCATCAAACA
GACTTCCCCAGGAAAAAGTGGCATGCCAAATTTGATGGAC
CACAGGACAGCAATGGAAGGCAGTGGGGATGGTGCACTTC
CCCCTTATCATCAAATGGGAGCACCATTGTATGAGGGAGC
TAGTTATGGGGCTGAGGGTGAAATGGCTCGGGCATACATG
GGTGGACCACCTGTCATGAACTACATGCCACCGCCTGCCA
ACCCTTCACAGGGTGCTACCATGGGAAACCCGATGGGACG
CCCTGCAAGTATGGGTGCTTACTCCACAAACATGGCTCCT
CAAAATAATACTGGGAATCCAATGTACACCCCTGGTCCAG
CCCAGCAAAAAGGATACCCTAGTGGGATTGACCAGGCCAT
GATGGGGTACAGTGTGTCTGGACCACCCATGCAAATCCAG
TCTCAGCCCTCAGGAGGGCCTGGAGCACATTATGACTACA
GGTCGCATATGATGGAGAATTCCAGCTACGGGGTCAAAAG
AAGTGCTTCCTTTCAGAATAAGATGCCCCAACTAACTACA
GAAAATTATGTCAATATGCCAAGCAAAGCAGCAATGGGCC
AAAATGCTGGTGGCTATGCTCCCAACTTATATCTGCCACC
ACATTCACATCCACGCCAAGCTAGCCCCACCTCACACCAG
GTTCACATGATGCAGCGCCCCCCAGGTGTTGCCCCTGGAG
CTATGGGTGGGGAGTTCTCTGATGTTCCTCAAGGCCTTCT
CACCCCTTCCAGGGCCAGTTTAAATCTTGACCTGTATGAG
CATCACTGGCCAGGAGCTCAAGGTCCTGAGGGGACTCCTC
CAGCCAGGCAGCCACAAGGGCCCTTCAGAGGGGAGGTACG
CGTCCCCAGTCGGACCAATTCTTTCAACAACCACCAAAAG
GTGACTGTGAGGCAGACATTGCCCCCAACAGCTAGTGTTG
CTGGGAAGCCAGAGTCATCTTTGGGCCCACCTAACACAAT
AACTGCAGTGACCTCTCCACCAATTCAGCCACCTGTTAAG
AGTATACGGGTCATGAGGCCTGAGCCGAAGACAGCAGTGG
GACCATGCCATCCAGGGTGGCTGAGTGCACAATCCCCGGA
AGCACAGGATTCTCTTGGATACATCCCAGATGAGAATTTT
ACCCTGGAACCCAGTCAAGAACATCGATGCCCACCTCCAC
CTTACCCCAAAACACTGCTTGTGTCTGGATCTGGACCTGA
GCCTGCATCCTTAGAGCCTGTAGCCATGAGTGGACTTCAA
GATGTCAGTGCCACAGGTAGGACTATCCAGAGTTCCTCGG
TAGGAAAGCAGGAGGAATCCATCTTCAAAGACAAAGTGAA
AATGGGCAAAGGAGAAAAGGCTGTGAAGGATAAGAAGCAG
ATCCAGACATCACCTGTGCCTGTACGAAAAAATGCCCGTG
ATGAAGAGAAGAGGGAGTCTCGTATTAAGAGTTATTCTCC
ATTTGCCTTTAAGTTCTACATGGAGCAACATGTGGAGAAT
GTGATGAAGACATACCAGCAGAAACTTAATCGCAGAATGC
AGCTGGAGCAAGAGATGTCCAAGGCTGGCCTTTCAGAGGC
TGAGCAGGAACAGATGAGAAAGATGCTTTACCAGAAGGAA
TCCAATTACAATCGACTACGACGTGCCAAGATGGACAAAT
CAATGTTTGTCAAAATCAAGACACTCGGCATTGGGGCCTT
TGGTGAGGTGTGTCTAACCCGAAAAGTAGACACAGGAGCC
TTGTATGCAATGAAGACTTTGCGAAAGAAAGACGTTCTTA
ACCGAAATCAAGTAGCCCATGTTAAAGCTGAACGGGACAT
TTTAGCAGAGGCTGACAATGAGTGGGTAGTCAGGTTGTAC
TATTCATTTCAAGACCGAGACAATCTGTATTTTGTCATGG
ATTACATTCCTGGAGGAGATATGATGAGCTTGCTGATCCG
TATGGGAGTTTTTCCAGAGGTCTTAGCCAGGTTTTATGTG
GCAGAACTGACACTGGCAATTGAGAGTGTGCATAAGATGG
GTTTCATCCACAGAGATATCAAGCCAGACAATATCCTCAT
TGACCTGGATGGACACATCAAACTGACTGATTTTGGTCTA
TGTACGGGGTTCCGATGGACTCACAACTCAAAGTATTACC
AAAAAGGGAACCATATCCGACAGGATAGCATGGAGCCAAG
TGACTTTTGGGATGATGTGTCTAATTGCCGTTGTGGTGAC
CGGCTGATGACTTTGGAACAGAGAGCAACTCGACAACACC
AGCGCTGCCTGGCGCATTCTTTGGTGGGCACCCCTAACTA
CATTGCCCCTGAGGTGCTTTTGCGCAAAGGATACACACAG
CTGTGCGACTGGTGGAGTGTGGGAGTGATCCTGTTTGAGA
TGCTGGTTGGCCAACCACCCTTTCTTGCTCCAACCCCAAC
AGAGACGCAGCTTAAGGTGATAAACTGGGAGAACACTTTG
CAAGTGCCACCACAAGTAAAACTAAGCCCAGAGGCAGTCG
ATATTATTGGCCAGCTTTGCTGCTCTGCTGAAGAGCGTCT
AGGAGGCAATGGGGCTGGAGAAATAAAGGCTCATCCTTTT
TTTTCCGAGGTGGATTTCTCCAGCAATCTTCGGACACAAC
CTGCACCATATCGACCAAAAATTGCCCACCCCATGGATAC
ATCCAACTTTGATCCTGTTGAAGAGGAGGGAGGCCCAGGC
GCCTGGAGTGATAGTGGGGATAGCACCCGCACTTGGGACA
CCCTCTGTTCTCCTCACGGCAAACACCCTGAACATGCCTT
CTATGAGTTTACTTTCCGAAGATTTTTTGATGATAATGGT
TGTCCATTCCGTTATCCCAAACCCCTAGAGGCGACACAAA
GCCTGTCCAGCAGTGACGGGGCCGGCAGCCTGAAGCCTGA
GCTGGAGGAGGAAGAGGCCCATGAAGAGGAAGAGCAAGGG
GAAGGGTGTGAGCCGGTTTATGTGTGAAAACGTTGGATTG
GTTGTTCATGCTGCTCTGCCTTTACCCATGGAGGACCTCA
CC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lats2-204 Contained in:
[BAC] CH211-173O4 (1), RP71-68N21 (1)

Genome Resources: Vega_Trans:OTTDART00000034493 (1),  Ensembl_Trans:ENSDART00000139620 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD596921 (1) 650 bp
GenBank:EB831503 (1) 628 bp
GenBank:EB932787 (1) 597 bp
GenBank:CR928789 (1) 539 bp
GenBank:EB885669 (1) 435 bp
GenBank:EB838472 (1) 259 bp
CITATIONS (3)