Transcript

neurod1-201

ID
ZDB-TSCRIPT-090929-15271
Name
neurod1-201
Previous Names
  • neurod-001
  • neurod1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034480 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034480|OTTDARG00000026058|ZDB-GENE-990415-172 neurod1|OTTDARP00000027792 neurod-001 LG_ CR753862.32 Danio rerio protein_coding KNOWN, 2422 bp
CTTTCTTTCGGCCACAAAGGGACGGAATACGGAGCTCTGG
CGAATACAAATGAAAGAGATCACGTGACGCTTGAGGCCGT
TTTCCTGACGTAGTCGGCCATATGGCGCGTGCCGGGGGAA
GGGGCGGGGCCAGATGTCAATCACGGGCGCAGGGTGGGAC
TGTAGAGGCAGCCGCAGACACACATCCACGCGCATCTCCC
AGCATCAGCAGCACCGCTATATAACCAGAGCATCCCATCA
GCGCAAGCCACACTAGACTTCAATCCGTAGGACTTCCTAT
ACCACGAAGGGCATGAAACTATCATAACAAGCTTTCAACA
CACCCTAGAGTTCCGACATGACGAAGTCATACAGCGAGGA
AAGCATGATGCTGGAGTCTCAGAGCAGCTCGAACTGGACC
GACAAGTGTCACAGCAGCTCCCAAGACGAACGAGACGTGG
ACAAGACCAGCGAGCCCATGCTCAACGATATGGAAGACGA
CGATGATGCCGGTCTCAACCGACTCGAGGATGAGGACGAC
GAGGAAGAAGAAGAGGAGGAAGAAGACGGCGACGACACCA
AGCCGAAAAGACGGGGTCCCAAGAAGAAGAAGATGACCAA
GGCGCGTATGCAGAGATTCAAGATGCGGCGCATGAAGGCG
AACGCCCGGGAGAGGAACCGCATGCACGGCCTCAACGACG
CGCTTGAGAGCCTGCGCAAAGTTGTTCCGTGCTACTCCAA
AACGCAGAAGCTCTCCAAGATCGAGACGCTCCGACTAGCC
AAGAACTACATTTGGGCTCTTTCGGAAATCTTGAGGTCGG
GCAAAAGCCCCGACCTGATGTCTTTTGTGCAGGCCTTGTG
CAAGGGCTTGTCCCAACCCACGACCAACTTGGTCGCAGGA
TGCCTCCAACTGAACCCCAGAACTTTTCTGCCCGAGCAGA
GCCAGGAGATGCCCCCTCATATGCAAACAGCAAGTGCTTC
CTTTTCCGCTCTTCCCTACTCCTACCAGACGCCCGGTCTT
CCCAGCCCTCCGTACGGTACAATGGACAGCTCTCACATCT
TTCACGTCAAGCCGCACGCGTACGGGAGCGCACTGGAGCC
GTTCTTTGACACCACCCTCACAGACTGCACCAGTCCCTCA
TTTGACGGACCCCTTAGCCCGCCTTTAAGCGTCAACGGGA
ACTTTTCGTTCAAACACGAGCCTTCTTCGGAATTCGAGAA
GAACTACGCGTTTACCATGCACTATCAGGCAGCGGGTCTG
GCCGGCGCGCAGGGACACGCCGCGTCTCTTTACGCGGGCT
CGACGCAGCGCTGTGATATACCGATGGAGAACATTATGTC
GTACGACGGGCACTCGCATCACGAACGGGTCATGAACGCC
CAGTTGAACGCGATATTTCACGACTCGTGATCCTAATGGA
CTTTTATCAGACTGCTCGACACGGTATTCTGTTATGGCTG
ATGCAAAAAGAGCAACAACATTATATGCTTAATCTTATGT
ACGTATTTATTGTTGTTACTGCCTTTAGGAGAAAAGAGAA
TTGGTTGATTCTCGTTCACCTTATGTATTGTATTCTATAG
CGCTTCTACGTTGCGGTCACACACACAGACACACACACAC
ACAAACACAGGTGGGAATAGGCGTGACCTTGTTCAGAATG
TGTTAATTATCCATGCTACAAAATCTCACAAGCAATAATT
TGGAAACTATGCAATTTTTAATCCAATACTGGGCCAATTA
TAGAAATTAATAGAGATTGATATATTTTTCAACCTATTAC
ATTTTACTACTTATCGATCCCATACTGAATTATTTTGTTG
TGATTTTGTATAGAATTGTTAATTTTTATAAAGTCAGATC
CCTGCGTCATTCCATGCTACCCCTCCATGTTAATGTTTTA
TAAAACTGATTTATCTCTCGTTTATATACGAAACAGTACT
CAATCTAGTAATAACCAGCAGGCAAGTGCTAAAAAATCTG
TAATGTTGCCTTAGCAATGAATTACTGTAAAATCATGCAG
AGTTGCACAATTCCCGTCCTCTGAATCCCGTCTAATGTTA
TGTTCAATCAGTGATCCTTTGTGGAAATTCGAATTGCTTG
AATGCTGGGGAAGAGGAAAAGAAAATAAAACAAATCGGTG
TTAGAAGTCTCAGTGTTGTAAATAAAAAAAGCTTGACTAT
CACCTTTTTAATTCACCCTGTGTTAAAAAAAAGCTGATCG
AGAGGCCTGTCTTTCTAAGATGGAGAATAAATAATGAACT
GAATTAGTCTGCTCAAACTATTCGGGTATTTTCGACTGGA
ATTTGTGTTGTGAAGGAACAAATGATGAAGATGCAACCAA
AAAGAGGTTGATTTAAAAGTCATTCTAGTTTTGAGACTGT
TGTATGTGTGTATCAGTTCATGATGGAGATTTACGAAATA
AAACAAATGGTTTTGAATTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations